Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Kireeva N. , Baskin I.I. , Gaspar H.A. , Horvath D. , Marcou G. , Varnek A. в журнале Molecular informatics , издательство Wiley-VCH Verlag (Weinheim, Germany, Germany) , том 31, ? ... Авторы: Marcou G. , Баскин И.И. , Horvath D. , Varnek A. 18th EuroQSAR. ...

Еще в разделе: (Показать все результаты (>5095) - istina.msu.ru/ )

• Horvath Dragos - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Kireeva N. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Varnek Alexandre - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

C/Base . C/Base is a 4GL database development system. ... Defining a database structure for file attributes. Designing entry and query forms programs. Designing and generating reports. ... None . ... User Comments: . ... SAL Home | Database Systems | Utilities Other DBMS . Comments? SAL@KachinaTech.COM . Copyright 1995-2001 by Herng-Jeng Jou . Copyright 1997-2001 by Kachina Technologies, Inc. ...

Еще в разделе: (Показать все результаты (>2748) - www.sai.msu.su/ )

• SAL- Database Systems - Relational DBMS - Recital
• SAL- Database Systems - Utilities Other DBMS - Qbib
• SAL- Database Systems - Relational DBMS - Paloma

XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>3) - scon155.phys.msu.ru/ )

• XAFS Publication Database search form

Home . ... Activities . ... Laboratory of Mathematical Methods of Image Processing . Chair of Mathematical Physics . ... Image enhancement . ... Rank image filtering . Image analysis . ... Ringing effect . ... Database . ... Medical imaging . ... Multiresolution analysis and processing . ... The final version of the developed ringing database is available here: . ... The ringing extension of TID 2013 database: . ...

Еще в разделе: (Показать все результаты (>553) - imaging.cmc.msu.ru/ )

• View publication | Laboratory of Mathematical Methods of Image Processing
• Ringing effect modeling | Laboratory of Mathematical Methods of Image...

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... We found that automatic models are significantly worse at predicting attention than even single-observer eye tracking. We propose a semiautomatic approach that requires eye tracking of only one observer and is based on time consistency of the observer?s attention. ... Gitman Y, Erofeev M, Vatolin D, Bolshakov A, Fedorov A. Semiautomatic Visual-Attention Modeling and Its Application to Video Compression . ...

Еще в разделе: (Показать все результаты (>257) - graphics.cs.msu.ru/ )

• Semiautomatic Visual-Attention Modeling | Лаборатория компьютерной графики и
• High quality stereo-to-multiview generation | Graphics and Media Lab
• High quality stereo-to-multiview generation | Лаборатория компьютерной графики

... Query = PYRB_ECOLI P0A786 Aspartate carbamoyltransferase catalytic chain (EC 2.1.3.2) (Aspartate transcarbamylase) (ATCase). (311 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: ( bits ) Value embl |AE006119|AE006119 Pasteurella multocida subsp . multocida st... 77 9e-16 embl |AE006208|AE006208 Pasteurella Pm70 section 86 of 204 of the complete genome. ...

Еще в разделе: (Показать все результаты (>8563) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/blast_3.txt
• http://kodomo.fbb.msu.ru/~smivic/Projects/Term_3/Downloads/gluq_pm.blast
• http://kodomo.fbb.msu.ru/~ogion/projects/Evolution_of_sequences/hemn_yp.blast

. ЭКОЛОГИЧЕСКАЯ ИНФОРМАЦИЯ . WEB- ориентированная библиографическая база данных .

Еще в разделе: (Показать все результаты (>49) - ecoinformatica.srcc.msu.ru/ )

... Query= sp|P0AAI3|FTSH_ECOLI Cell division protease ftsH OS=Escherichia coli (strain K12) GN=hflB PE=1 SV=1 (644 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006080 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... Pm70 sectio... 48 2e-06 AE006234 Pasteurella multocida subsp. multocida str. ... Pm70 section 47 of 204 of the complete genome. ...

Еще в разделе: (Показать все результаты (>2921) - kodomo.cmm.msu.ru/ )

• SDAP : Structural Database of Allergenic Proteins

Электронная библиотека Попечительского совета . ... Michalski B. - Perl Database Programming . ... Название: Perl Database Programming . ... Here's your in-depth guide to creating database-driven applications using Perl. In this authoritative reference, Perl expert Brent Michalski uses plenty of examples to help you master Perl's capabilities in database applications with MySQL, PostgreSQL, and Oracle. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>11928) - lib.mexmat.ru/ )

• Price J. - Mastering C# Database Programming :: Электронная библиотека
• Gosnell D., Reynolds M., Forgey B. - Beginning Visual Basic .Net Databases ::
• McManus J.P., Goldstein J. - Database Access with Visual Basic .NET ::

... 32Bits Online: because there's more than one way to compute . New about new versions of computer related stuff . AAA Matilda Web Search . ... Search . ... The Music Database . ... Musicians looking for other musicians (Free Service) . ... The Mac Game Database uses PHP and MySQL . ... Bioinformatics databases at the Montreal Children's Hospital using MySQL . ... DSL providers search with reviews Made with MySQL and Modperl, all pages are generated dynamically out of the MySQL database . ...

Еще в разделе: (Показать все результаты (>284) - itpm.msu.su/ )

• The paths database
• nn Configuration
• Getting Acquainted with NIS

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>6) - edas2.bioinf.fbb.msu.ru/ )

• Alternative Splicing DataBase.
• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

Laboratory of Informatics . Head of Laboratory E.S.Polischuk, senior researcher, DSc . ... research guidance of a four year student's project in the Faculty of Geography (N.M. Chernavskaya, DSc) . ... Grant of RFBF (Russian Foundation for Basic Research) 01-03-00332, the head of the project prof. R.B.Rybakov, Institute of Orientalistic (Russian Academy of Science), N. M. Chernavskaya - performer . ... N.M.Chernavskaya, DSc, senior researcher, T.B.Pleskacheva., DSc, senior researcher. ...

Еще в разделе: (Показать все результаты (>122) - srcc.msu.ru/ )

• Научно-исследовательский вычислительный центр МГУ

Database: . ... Affymetrix official site . ... Clone/Gene ID converter . ... Probe set search: . Affymetrix probe set identifier example: "238900_at" . ... Search . Text search: . Gene official symbol (*-wildcard) example: "c1orf*" . Word or phrase in gene official name example: "receptor" . ... Gene search: . ENSEMBL gene identifier example: "ENSG00000026508" . NCBI Entrez Gene identifier example: 7503 . HUGO gene identifier example: 1681 . ...

Еще в разделе: (Показать все результаты (>9) - mouse.belozersky.msu.ru/ )

... use prefix && EPREFIX= has "${EAPI:-0}" 0 1 2 && ! use prefix && EROOT="${ROOT}" if [ -x "${EPREFIX}/usr/bin/update-desktop-database" ] then einfo "Updating desktop mime database .. EPREFIX}/usr/bin/update-desktop-database" -q "${EROOT}usr/share/applications" fi } # @FUNCTION: fdo-mime_mime_database_update # @DESCRIPTION: # Update the mime database. ... use prefix && EROOT="${ROOT}" if [ -x "${EPREFIX}/usr/bin/update-mime-database" ] then einfo "Updating shared mime info database .. ...

Еще в разделе: (Показать все результаты (>17230) - mirror.msu.net/ )

• http://mirror.msu.net/pub/slackware-current/slackware/l/libdiscid-0.6.1-i486-1.txt
• http://mirror.msu.net/pub/gentoo-portage/mail-filter/sqlgrey/sqlgrey-1.7.6-r1.ebuild
• http://mirror.msu.net/pub/gentoo-portage/app-misc/devtodo/files/devtodo-0.1.20-gentoo.diff

Related papers . ... N. N. Nepeyvoda, Logics and programming's styles (Russian, PDF). ... Abstract. ... D. Levshin Semantic Web and PostgreSQL Integration Algorithms (Russian, PDF). ... We consider Semantic Web and PostrgreSQL DBMS integration. Analysis of known systems for using databases with Semantic Web is performed, PostgreSQL features that can be useful for integration implementation are emphasized, integration methods and algorithms are proposed, and one of these algorithms is implemented. ...

Еще в разделе: (Показать все результаты (>119) - sp.cs.msu.ru/ )

... The department was founded in late sixties by Prof. D.Ya.Martynov, who for many years was also the director of Sternberg Astronomical Institute. At present time, the head of the department is Prof. A.M.Cherepashchuk, a pupil of D.Ya.Martynov and his successor as the director of SAI. Since Prof. Martynov, the scientific activity of the department was primarily related to binary stars. ... The department consists of 15 members most of which have Ph.D. in Astrophysics. ...

Еще в разделе: (Показать все результаты (>17) - uranus.sai.msu.ru/ )

• The Database of Close Binary Systems

About BAFIZ . ... BAFIZ is a program devoted to the development of a distributed network of the knowledge and data bases for research of fundamental properties of the matter and applied nuclear physics. The project sponsored by Russian Foundation of Basic Research , RFBR reference number is 95-07-19502. ... This Page is developed at Laboratory of Computational Mathematics, . ... Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...

Еще в разделе: (Показать все результаты (>27) - dbserv.sinp.msu.ru/ )

... Protein sequences: . ... OWL : non-redundant database assembled from a number of primary sources including translations of nucleic acid sequences (Swissprot, PIR, NRL3-D and GenPept). ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering all complete protein sequences in SwissProt. ... The Genome Sequence Database: complete relational database of DNA sequences and annotation . ...

Еще в разделе: (Показать все результаты (>231) - www.genebee.msu.ru/ )

• GeneBee
• The Russian EMBnet Node
• Notes on searching by similarity

PHP Manual . ... Persistent connections are SQL links that do not close when the execution of your script ends. ... People who aren't thoroughly familiar with the way web servers work and distribute the load may mistake persistent connects for what they're not. ... For example, if you had 20 different child processes that ran a script that made a persistent connection to your SQL server, you'd have 20 different connections to the SQL server, one from each child. ... Connection handling . ...

Еще в разделе: (Показать все результаты (>545) - oit.cmc.msu.ru/ )

• Database (dbm-style) abstraction layer functions
• What can PHP do?
• FrontBase Functions

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out