ВМиК-Online! ... Факультет . ... Абитуриенты . ... Вариант письменного вступительного экзамена . по английскому языку . Отделение бакалавров факультета ВМиК . ... They found that cannabis users are 40 percent less effective in fighting viruses than normal people. ... Группа В Контакте для абитуриентов ВМК МГУ: . Поступление на ВМК МГУ 2012 . Форум абитуриентов ВМК МГУ . ... Телефон приемной комиссии факультета ВМиК МГУ: . ... 2001 2012 ВМиК Online! ...

Еще в разделе: (Показать все результаты (>3) - www.cmc-online.ru/ )

miniSTRY OF HEALTHCARE AND SOCIAL DEVELOPMENT RF NORTHERN RESEARCH CENTER NORTH-WEST BRANCH RAMS federal service for hydrometeorology and environment monitoring (rosgidromet) MINISTRY OF HEALTHCARE AND SOCIAL DEVELOPMENT OF ARKHANGELSK REGION territorial administration of federal service for consumers' rights protection Surveillance and human well-being in arkhangelsk region NORTHERN STATE MEDICAL UNIVERSITY [pic] NEWSLETTER of the All-Russian Science-and-Practice ...

Еще в разделе: (Показать все результаты (>23) - www.anthropos.msu.ru/ )

... Porokhov, N., Kalabukhov, A., Chukharkin, M., Maresov, A., Khrykin, D., Klenov, N., and Snigirev, O. The physical basis of the fabrication of the third generation of high-temperature superconducting wires on quartz substrates.љ ... DOI љ] . ... Journal of Superconductivity and Novel Magnetism љ(2014). ... Сhukharkin, M., Kalaboukhov, A., Schnaiderman, J., Oisjoen, F., Jonsson, M., Xie, M., Snigirev, O., Winkler, D. Novel hts dc squid solutions for nmr applications. ... Superconducting electronics . ...

Еще в разделе: (Показать все результаты (>8) - cryolab.phys.msu.ru/ )

• Publications (2001-2010)

... Point-split stress tensor and the Green's function. ... Casimir effect for a massless scalar field between two plates with the Dirichlet boundary conditions: one-particle states between the plates, explicit energy regularization and renormalization using the smooth cutoff. ... Casimir tension of a massless scalar field between two plates with the Dirichlet boundary conditions using the Green's function technique (the `pressure' Tnn version). ... Casimir energy renormalization. ...

Еще в разделе: (Показать все результаты (>5) - theorphys.phys.msu.ru/ )

• http://theorphys.phys.msu.ru/education/aqft_slides/ExamSyllabus_Term2.pdf

trendence Graduate Barometer Europe 2011 About the survey ­ About trendence trendence Graduate Barometer Europe is an annual online student survey which allows students to express their opinion on topics re lated to career and education. ... Ulrike Heyne Project Manager trendence Graduate Barometer Europe 2011 About the survey Facts and benefits How does it work? ... If your students take part in the trendence Graduate Barometer, they will receive an exclusive Student Report. ...

Еще в разделе: (Показать все результаты (>3) - studsov.math.msu.su/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• ConClus
• Nhunt
• StructAlign feedback

... Antal , T.K., Volgusheva , A.A., Kukarskih , G.P., Krendeleva , T.E., Rubin, A.B. Relationships between H 2 photoproduction and different electron transport pathways in sulfur-deprived Chlamydomonas reinhardtii (2009) International Journal of Hydrogen Energy, 34, pp. ... Antal , T.K., Volgusheva , A.A., Kukarskikh , G.P., Krendeleva , T.E., Tusov , V.B., Rubin, A.B. Examination of chlorophyll fluorescence in sulfur-deprived cells of Chlamydomonas reinhardtii (2006) Biofizika ., 51 (2), pp. ...

168. MSU Chamber Orchestra. Hystory.

169. Высшая школа бизнеса МГУ им. Ломоносова

170. HP Graduate Development Program 2010 / Вакансии / Physcareer.ru

171. http://mailybaev.imec.msu.ru/papers/MailybaevEtAl2005.pdf

172. http://tunka.sinp.msu.ru/en/presentation/horns_vhe.pdf

173. The brain natriuretic peptide (BNP) precursor is the major immunoreactive form

174. Group of Hydrothermal Synthesis :: Sergey V. Balakhonov

175. http://num-anal.srcc.msu.su/eng_math/redict/10.htm

176. http://www.kosmofizika.ru/buri/vesel2.pdf

177. http://ics.org.ru/upload/iblock/38e/121-euler-poisson-equations-and-integrable-cases_ru.pdf

178. K-corrections calculator

179. http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc2396.txt

180. http://semiconductors.phys.msu.ru/publ/JETPLett_89_457.pdf