MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 15, 2013 1 - The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2013" 1. ... Administrative law 2. ... Members of the Council of Experts: Golichenkov Alexander Konstantinovich (Head of the Law Faculty, head of the chair of land and ecological law, Doctor in Law, Professor) Romanov Stanislav Vladimirovich (Deputy Dean on instructional work, Candidate in Law, Docent). ...

Еще в разделе: (Показать все результаты (>5) - www.law.msu.ru/ )

To see a Russian version of this page, click here . ... Bochkarev Nikolai Gennadievich . astrophysics researcher: . born: Moscow, May 19, 1947; . ... Jr. researcher Sternberg Astronomical Inst., ... Soviet (Russian) Working Group on Interstellar Matter, Moscow , 1979-; . ... Madison, 1991. ... ALocal Interstellar Matter, 1990, . Basic Physics of the Interstellar Matter, 1992; co-author: . ... Physics of Interstellar Matter, 1979; . ... All-Union Astronom. Geodesical Soc., ... Astronom. ...

Еще в разделе: (Показать все результаты (>12) - uranus.sai.msu.ru/ )

... Geography of World Economy . ... Recreational Geography and International Tourism . ... Physical Geography and Landscape Science . ... About Faculty . ... Research laboratories . ... Field stations . Faculty branches . ... Education . Undergraduate study . ... Type of field courses . ... Russians, that have an education at university level, are allowed to study on government-sponsored places. Foreigners can receive only rental education, they have to conclude a contract with the faculty. ...

Еще в разделе: (Показать все результаты (>5) - www.eng.geogr.msu.ru/ )

• Undergraduate study

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... X-COM: Distributed Computing Software . ... In mellow autumn time Moscow cordially invites HPC specialists to take part in Russian Supercomputing Days, the brand new international supercomputing conference that unites several traditional Russian and international HPC events. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ... Russian Supercomputing Days International Conference . ...

Еще в разделе: (Показать все результаты (>41) - hpc.msu.ru/ )

• Supercomputing Education Project | Moscow University Supercomputing Center
• Nationwide Supercomputing Education Project | Moscow University Supercomputing
• Trainings on Application Development and Optimization | Moscow University

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• Nhunt: program for nucleic acid sequence similarity search

... Архитектура пакета . ... Пакет содержит типы данных и алгоритмы для поддержки теории формальных языков в системе Maple. ... Для представления символов используется тип type/character , Для представления цепочек тип type/string . ... Основной новый тип: Language . ... Каталог с исходными текстами пакета имеет следующую структуру. src\ . ... Конструкторы и утилиты к типу Language . ... Конструкторы и утилиты к типу Acceptor . ... конструкторы объектов имеют префикс new , например: newLanguage() . ...

Еще в разделе: (Показать все результаты (>3) - al.cs.msu.ru/ )

... A Proposal for an International Atlas of Lunar Exploration Philip J. Stooke Department of Geography University of Western Ontario London, Ontario, Canada N6A 5C2 Introduction. ... I propose the creation of an International Atlas of Lunar Exploration to tell this story in cartographic form. ... Many new products would be based primarily on spacecraft images rather than drawn maps, which will also reduce costs and help illustrate the primary data products of the principal lunar missions. ...

Еще в разделе: (Показать все результаты (>75) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Symposium/sternber.pdf
• http://selena.sai.msu.ru/Laz/Publications/6_Automatic%20creation%20of%20the%20hypsometric%20map%20of%20Venus.pdf
• http://selena.sai.msu.ru/Chik/Publications/Aitken/MS015.pdf

... User account . Create new account (active tab) . ... E-mail address * . A valid e-mail address. All e-mails from the system will be sent to this address. The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. ... Language settings . Language . ... This account's default language for e-mails. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>27) - hsmi.msu.ru/ )

• We are assembling training courses! | MSU Higher school of management and
• Admission committee | MSU Higher school of management and innovation

Mechmath admission for internetional students . Specialist degree . ... Specialist variants . Master degree . ... Master variants . ... The specialist programme is a first step to the science in a life of every man. On the morrow of the education, students get a specialist degree and a diploma of higher education in two languages . ... The list of enterance examinations for Mathematics and Mechanics Faculty?s entrants . ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>5) - pk.math.msu.ru/ )

• Information | Mechmath admission for internetional students

trendence Graduate Barometer Europe 2011 About the survey ­ About trendence trendence Graduate Barometer Europe is an annual online student survey which allows students to express their opinion on topics re lated to career and education. ... Ulrike Heyne Project Manager trendence Graduate Barometer Europe 2011 About the survey Facts and benefits How does it work? ... If your students take part in the trendence Graduate Barometer, they will receive an exclusive Student Report. ...

Еще в разделе: (Показать все результаты (>3) - studsov.math.msu.su/ )

• http://studsov.math.msu.su/Sites/studsovet/Uploads/trendence_Country_Report_Russia_Engineering_2010.docs1.pdf

script language= javascript on=mw=null; fl=ofl=0; mc=me=0; t=0; b=0; ch=bt=bn=0; wn=wt=null; sl=0; t2=0; function Is0CC28989() { this.n=(document.layers)?true:false; this.o=(navigator.userAgent.indexOf('Opera')!=-1)?true:false; this.i=(document.all (!this.o))?true:false; this.d=(document.getElementById)?true:false; } var is0CC28989=new Is0CC28989(); function Stor() { if(is0CC28989.n (top.frames.length 0)){ return top.frames[0]; } ...

Еще в разделе: (Показать все результаты (>45) - www.kosmofizika.ru/ )

• Science Technology: Ongoing Solar Activity

... We will dwell on linguistic aspects and Lexical Resources of POLITEXT branch having in mind some intermediate semantic representation of a whole text as the basis for differentiated Information Extraction. It is personal data (in the social sphere) recognition in texts that we focus on, see (Leontyeva et al. ... As the main instrument of semantic analysis of coherent texts this dictionary bears the important information on how to build BTF-units starting from lexemes of SemDict entries. ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

• Semantic Resources for Textual Content Compression
• Semantic Dictionary for Text Understanding and Summarization

... This is a bug fix release for the 3.x series of Joomla. ... Project and the Production Leadership Team are proud to announce the release of Joomla! 3.5 as the latest in the 3.x series. ... CMS 3.5 Release Candidate 4 . ... CMS, with 3.5 the sixth standard-term support release in this series. ... That being said, please do not upgrade any of your production sites to the release candidate version as a release candidate is ONLY intended for testing and there is no upgrade path from a Release Candidate....

Еще в разделе: (Показать все результаты (>2) - biophys.phys.msu.ru/ )

... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... Institute of Mechanics, Lomonosov Moscow State University, Michurinsky Prospekt, 1, 117192, Moscow, Russia . ... S.-Petersburg, 195251, Russia. ... Institute for Problems in Mechanics of Russian Academy of Sciences . ...

Еще в разделе: (Показать все результаты (>2) - www.imec.msu.ru/ )

• EUROMECH Colloquium-458

. Источники: . 226 Ra . Неизвестные . 1 . 2 . 3 . 4 . Масшаб по Y: . 32 64 128 256 512 1024 2048 4096 8192 16384 32768 65536 . Время измерения . 1 2 3 4 5 6 7 8 9 10 50 100 сек . alt=" Your browser understands the APPLET> tag but isn't running the applet, for some reason." Your browser is completely ignoring the APPLET> tag!

Еще в разделе: (Показать все результаты (>103) - nuclphys.sinp.msu.ru/ )

• Определение расстояния между источником и детектором
• Определение периода полураспада и сечения взаимодействия тепловых нейтронов
• Определение толщины пластин

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>3) - bioinf.fbb.msu.ru/ )

... Department of Mathematics, . Faculty of Physics, MSU . ... Differential equations . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . ... Abstract differential equations with applications in mathematical physics . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Methods of finite differences in mathematical physics . ... Inverse problems in mathematical physics . ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>8) - math.phys.msu.ru/ )