Alexander S. Antonov . ... M.V.Lomonossov Moscow State University . ... June 4, 1999, Moscow State University . ... 1994-2000: programmer, Laboratory of Parallel Information Technologies, Research Computer Center, Moscow State University . ... A.S. Antonov, A.M. Teplov. ... Antonov A.S., Voevodin Vl.V., Sobolev S.I., Filamophitskiy M.P. Internet-Auditorium of Lomonosov Moscow State University // Abstracts of the All-Russian scientific conference "Scientific Services Internet" (Novorossiysk, 2000). ...
... Laboratory staff participate in the RFBR grant 14-01-00420-аА in 2014-2016. Laboratory staff participated in the RFBR grant 11-01-00523-аА in 2011-2013. ... A. Galstyan participated with poster . Poster . ... International Conference on Mathematical Modeling in Physical Sciences . ... International Conference on Mathematical Modeling in Physical Sciences, 2013, 1-5 September, Prague, Czech Republic . ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...
... Moscow: Russian Library of Foreign Literature, 2009, 351pp. ... Moscow: Languages of the Slavic culture, 2007 (792 pp.) ... In: Russian, Slavic and Indo-European Studies. ... In: Sopostavitel'noe izuchenije slovoobrazovanija slavjanskix jazykov (Comparative study of derivation in Slavic languages), Moscow, 1986, pp. 150-156 (in Russian). ... 1958-- "On the Relations between Slavic and Baltic Languages," (in collaboration with V. N. Toporov), 4th International Congress of Slavic Studies, Moscow. ...
[
Текст
]
Ссылки http://www.imk.msu.ru/Structure/ivanov-bibl-eng.doc -- 134.0 Кб -- 25.11.2010
[
Текст
]
Ссылки http://imk.msu.ru/Structure/ivanov-bibl-eng.doc -- 134.0 Кб -- 25.11.2010 Похожие документы
... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...
3D Simulation of Stress - strain State in Pneumatic Tires. ... Moscow State University, Russia . Section 1.1 . ... Mechanical model for computation of Stress - strain State in pneumatic tires. ... Numerical simulation of axisymmetrical Stress - strain State in tires. ... Axisymmetrical Stress - strain State in tire. ... Numerical simulation of 3D Stress - strain State in tires . ... Solution of contact problem on tire contacting rigid surface in view of friction on contact surface. ...
Ботанический сад Московского Государственного Университета им. М.В. Ломоносова Российское Общество Ириса Задачи Международного сотрудничества ирисоводов (Тезисы докладов) Москва 2005 Посвящается: 250-летию Московского Государственного Университета имени М. В. Ломоносова и 300-летию Ботанического сада Московского Государственного университета Тезисы докладов Международного Симпозиума «Задачи международного сотрудничества ... Ирисы, как объект исследования. ...
[
Текст
]
Ссылки http://www.botsad.msu.ru/docs/simp.doc -- 828.5 Кб -- 30.08.2010
[
Текст
]
Ссылки http://botsad.msu.ru/docs/simp.doc -- 828.5 Кб -- 30.08.2010 Похожие документы
Lomonosov Moscow State University was established in 1755 . ... Lomonosov Moscow State University Diary . ... MSU Web Sites . ... General Information . ... Study and Research . ... MSU Online . ... Research Priorities in Sciences at MSU: . ... MSU-RAS Research Institute of Soil Science . ... Research Priorities in Humanities at MSU: . ... Research Priorities in Social Sciences at MSU: . ... Research Priorities in the Humanities at MSU: . ... Research Priorities in Sciences and Humanities at MSU: . ...
... Seminars . ... Group 417 [ PDF ] Students are expected to attend lectures and seminars which is the standard forum for class communication. ... Some of the homework problems might appear on the tests and the exam. ... Your class grade total percentage is given by 40% seminar and homework, 25% first test and 35% second test. ... Students with the class grade 5 and 4 may get a final course grade without a final exam, but only upon the recommendation of seminar assistants. ... Test 1 [ PDF ] . ...
... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...
... NetCDF User's Guide for C . ... 2 - Components of a NetCDF Dataset . ... 2.4 - Attributes . ... 3.1 - netCDF external data types . ... 7.5 - Write a Single Data Value: nc_put_var1_ type . ... 7.10 - Read a Single Data Value: nc_get_var1_ type . ... 7.12 - Read an Array of Values: nc_get_vara_ type . 7.13 - Read a Subsampled Array of Values: nc_get_vars_ type . 7.14 - Read a Mapped Array of Values: nc_get_varm_ type . ... 7.16 - Fill Values . ... 8.4 - Get Attribute's Values:nc_get_att_ type . ...
... Head of Analytical Chemistry Division, Department of Chemistry, Lomonosov Moscow State University. Principal researcher, Kurnakov Institute of General and Inorganic Chemistry, RAS. ... 1950-1955 - student of Department of Chemistry, Lomonosov Moscow State University. ... Since 1978 - professor of Analytical Chemistry Division, Department of Chemistry, Lomonosov Moscow State University; since 1989 - head of the Division (half time). ... USSR State Prize (1972) . ... Moscow State University . ...
... Issues of the year 2010 . ... Instructions for Authors . ... The scientific English language journal ‘GEOGRAPHY, ENVIRONMENT, SUSTAINABILITY’ aims at informing and covering the results of research and global achievements in the sphere of geography, environmental conservation and sustainable development in the changing world. ... In the text the surname of the author and the year of publication of the reference should be given in square brackets, i.e. [Author1, Author2, 2008]. ...
Transhumus : Integrated software solution for interpretation of FT-ICR mass spectra of natural organic matter Anton Grigoryev1, 2, Alexey Kononikhin 1 2 2, 3 , Irina Perminova4, Eugene Nikolaev2, 3 ansgri@gmail.com Institute for Energy Problems of Chemical Physics, Moscow , Russia 3 Institute of Biochemical Physics, Moscow , Russia 4 Lomonosov Moscow State University, Moscow , Russia Natural organic matter ( ... However, there still are problems with interpretation of mass spectra of NOM. ...
[
Текст
]
Ссылки http://www.mgumus.chem.msu.ru/publication/2010/2010-grigoryev-transhumus.pdf -- 315.1 Кб -- 26.11.2010
[
Текст
]
Ссылки http://mgumus.chem.msu.ru/publication/2010/2010-grigoryev-transhumus.pdf -- 315.1 Кб -- 26.11.2010 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...
... This is so elementary it hardly needs comment . ... Единица (меньше единицы по модулю) . ... Group unit element . ... Единичная геометрическая краткость . ... Unit normal . ... Let $v$ be a vector of unit length . Единичный вектор внешней нормали . Unit outer normal vector . Outer normal unit vector . Единичный вектор восходящей нормали . ... Единичный вектор касательной . ... Единичный вектор направления движения . ... Normal unit vector . Unit normal vector . ... One component . ...
Site navigation: . ... Publications . ... SPDC Laboratory . Quantum Electronics Chair . ... Site configuration . Error: You currently have Javascript disabled. ... The problem of preparing entangled pairs of polarization qubits in the frequency-nondegenerate regime?, ... Download [ help ]: . Download paper: doi page . Download paper: Full text . ... All persons copying this information are expected to adhere to the terms and constraints invoked by each author's copyright. ...
XXVIII General Assembly of the IAU, SPS15 Beijing, August 31, 2012 . N.N. Samus, S.V. Antipin "Variable Stars and Data-Intensive Astronomy" . During the 26th IAU General Assembly in Prague, the IAU Division V (Commissions 27 and 42) considered the future of variable-star catalogues. ... To discuss these problems and to look for their solutions, the IAU Commission 27, on behalf of the IAU Division V, created an informal working group, chaired by the GCVS editor, Dr. Nikolai Samus. ...