FNAL SELEX experiment. ... Моя Atlas страница здесь, в МГУ. ... Страница памяти Юрия Александровича Лазарева . ... Л.Д. Ландау ? ученый, учитель, человек?(.pdf) . ... Круг Ландау: Физика войны и мира?. 2009 г., 269 стр.) ... Л.Д. Ландау?(.pdf) . 32 стр.) ... Бонсай в Москве, декабрь 2015 г. Южная Индия в январе 2011 г. Петербург в ясном октябре 2010 г. Фото на станции метро Лубянка после теракта 29 марта 2010 г. (30 марта и 6 апреля). ... Фото Гелл-Манна , выступавшего в МГУ 25.09.2007. ...
... Доктор филологических наук профессор Юрий Николаевич МАРЧУК является видным специалистом по прикладной и компьютерной лингвистике , машинному переводу, автоматическому анализу и синтезу текстов, терминологии и терминоведению, лексикологии и лексикографии, общему языкознанию. ... Белов Алексей Михайлович, преподаватель, кандидат филологических наук . ... Качалкин Анатолий Николаевич, профессор, доктор филологических наук . Кочергина Вера Александровна, профессор, доктор филологических наук . ...
BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...
... Содар . Профилемер . Соник 5 м . ... Профилимер ЗНС . ... Данные . ... Содар Профилемер Соник 5 м Соник 10 м Профилимер ЗНС . ... Если Вас заинтересовали наши данные, ображайтесь к нам . ...
... Also during this work Dian drank a lot of tea with sugar, completed his description of urban and rural life (to the tunes of world-known musical "Notre-Dame de Paris"), wrote several poems about his dear friend GVR. ... Besides this project, Sergei A. Spirin with his colleague Andrew V. Alexeevski takes a very great part in different researches. Near their work room on the 3rd floor of the "A" laboratory building, near with the biological one, different colourful posters can be watched. ...
. Черноморская конференция МГУ Русская версия . Register . Login . Черноморская конференция МГУ . Apply to participate . Registration . Last name . Name . Middle name . Email: . Password: . Verification: . Gender . Not specified male female . Birthday . Register . ї Московский государственный университет . Документация . Мы в социальных сетях . 299001, г. Cевастополь, Героев Севастополя, д.7 . kdp@msusevastopol.net .
... Программа повышения квалификации ?Исследование природы вместе с детьми? ... День леса - 2013 . ... Содержание сборника, 2004 . ... из сборника Вместе со всей планетой , Пущино 1995 . ... Загадки и тайны мира природы очень интересны детям, даже самым маленьким. ... В 1995 г. мы вместе с учеными подмосковного города Пущино помогали школьникам выступить в роли экологических наставников для малышей . Заметка об этой работе была опубликована в журнале ЮНЕСКО Connect . ...
. Magnetism Department MSU . Main . Magnetism department . Stuff . Research groups . Collaboration . Education . Students . Phd students . Practical work . For 2 grad students . Library . Links . Grad. students . Various . Contacts . News . Registration on MISM 2011 is opened! . Lomonosov MSU . Faculty of physics . Made by: Kazakov A.P. and Fetisov L.Y.
... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. ... April 11, 2013 - Bashneft Group in conjunction with JSFC "Sistema" opened the programme for the development of key Bashneft Group management - School of CEOs, "Capsule of security". ... At the end of his Welcoming Speech President of Bashneft Group stressed that this programme ? ... The School of CEOs ? ... 2006-2016 MSU Higher School of Management and Innovation. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... В.Е.Юрасова, Современные теории катодного распыления и микрорельеф распыляемой поверхности металла, ЖТФ, 1958, 28, ?9, 1966-1970. ... V.I.Shulga, I.G.Bunin, V.E.Yurasova, V.V.Andreev, B.M.Mamaev, Influence of surface semichannels on ion scattering by crystals, Phys. Lett., ... Рентгеновские, синхротронные и нейтронные исследования, 2000, ? ... Особенности распыления сплавов Ni-Pd с разным содержанием компонент, Поверхность - рентгеновские, синхротронные и нейтронные исследования, 2006, ?7, 13- 17. ...
... CUDA Showcase - список приложений, использующих CUDA (на сайте NVidia). RapidMind Case Studies - примеры использования RapidMind для программирования ГПУ (и не только). AMD Stream Computing Blog - примеры использования вычислительной платформы AMD Stream Computing для программирования ГПУ от AMD. Core Image - компонент интерфейса программирования Mac OS X, использующий вычислительные мощности графического процессора для отрисовки эффектов пользовательского интерфейса. ...
... Conferences . ... International Conference "V Bredikhin Reading 2014", Zavolzhsk, Russia, May 12-16, 2014 (L.A. Egorova). 5th European Conference for Aeronautics and Space Sciences - EUCASS 2013, Munich, Germany, July 1-5, 2013 (V.I. Sakharov). International Conference "Near Earth Astronomy-2013", Agoy, Krasnodar region, Russia, October 7-11, 2013 (L.A. Egorova). ... International Meteor Conference 2012, La Palma Island, Canary, Spain, September 20-23, 2012 (L.A. Egorova). ...
. ПО КУ . Ссылки . Статьи и тезисы . Интернет . Литература . CVS-репозитории . Утилиты . Доступ к информации . Linux SAL Parallel Computing Page . http://suparum.rz.uni-mannheim.de/docs/ind.html . Partial evaluation for MPI optimization . Berkeley Reserach Areas . IOZone filesystem benchmark . SEL-HPC Article Archive . $Date: 2000/10/12 01:09:52 $ . Home . Andrey Slepuhin .
pic] The Ministry of Education of the Russian Federation The Scientific and Methodological Council on Foreign Language Teaching The (Russian) National Association of Applied Linguistics (NAAL) The Faculty of Foreign Languages and Area studies of Lomonosov Moscow State University DECent - The Distance Education Centre Dear colleagues, You are invited to participate in the 2nd International Scientific and Methodological ... Teaching and learning a foreign language at a distance. ...
SVETKA, a program for Analysis of Multiple Sequence Alignments . ... Analyse your alignment . ... Alignment . Nota Bene! .aln or .fasta format required!! Look here for comments . ... Nota Bene! Special scheme format required! ... Development of the program is supported by Ministry of Education and Science of the Russian Federation (State Contract No. ...
Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...