МГУ имени М. В. Ломоносова . ... кафедра рекреационной географии и туризма . ... Добро пожаловать на сайт кафеды рекреационной географии и туризма географического факультета МГУ. ... Учебный процесс на кафедре строится на принципах непрерывного многуровнего профессионального образования. ... В настоящее время кафедра реализует программы дополнительного образования по обычной (вечерней) и дистанционной формам обучения по следующим направлениям: . ... образования . ... Дополнительное к высшему (MBA) . ...

Еще в разделе: (Показать все результаты (>10) - tourism.msu.ru/ )

... Seminar archive . ... Type Ia Supernovae (SNe Ia) have an important role to measure a distance to an anonymous galaxy because they have a good correlation of the decline rates of the light curves with the absolute luminosity. ... First, super-Chandrasekhar SNe which have extremely high luminosity, slow decline rate of the light curves, slow expansion velocity and strong carbon features. ... As another example of diversity of SNe Ia, I would like also to introduce Type Iax SNe. ... All seminars: . ...

Еще в разделе: (Показать все результаты (>12) - master.sai.msu.ru/ )

• SAI Space Monitoring Laboratory

Home . Data . ... Meteor-M тДЦ1 . ... Meteor-M тДЦ2 . ... Solar energetic particles . ... Solar flare database (RU) . ... Space Monitoring Data Center of SINP MSU (SMDC) collects the data of space experiments as well as scientific and applied models for studying the geomagnetic and radiation conditions in the near-EarthтАЩs space environment. ... Latest data from featured spacecrafts . Meteor-M #1 is alive! ... Space weather now . ... NOAA N3KL Solar Activity Monitor . ... Developed in 2007. ...

Еще в разделе: (Показать все результаты (>15) - smdc.sinp.msu.ru/ )

• Space monitoring data center
• Space monitoring data center INTERHELIOS PROJECT

University Satellites and . Space Science Education . ... Space methods in education of ecologists . ... Application of space methods at the decision of environmental problems finds reflection in teaching a lot of disciplines of a geoecological cycle baccalaureate and master degree preparations (geology, geography, landscape, a remote quality monitoring of a condition of an environment etc.) ... Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>6597) - cosmos.msu.ru/ )

... Introduction The purpose of this paper is to define the meaning of the Bronze Age Luvian lexeme 416-wa / i-nМ -.1 It occurs several times in the inscriptions YALBURT and SэDBURG , which contain the res gestae of the two Hittite kings of the late Empire period, Tuthaliya IV and Suppiluliyama II, and once in the inscription KIZILDA' 4, which commemorates the deeds of a certain Hartapu, possibly a king of Tarhuntassa.2 The frequency of this word in the Bronze Age ... The Luvian Enemy 19 ­ 1997...

Еще в разделе: (Показать все результаты (>21) - imk.msu.ru/ )

• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/sippanti.pdf
• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/refl-ucla.pdf
• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/upe.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• ConClus

... distant.msu.ru . ... Видеоархив МГУ . Список курсов . ... Курсы факультетов МГУ . Географический факультет . ... Курсы для школьников / Курсы от школ-партнеров / ГБОУ Гимназия ?1272 Курсы для школьников / Курсы от школ-партнеров / ГБОУ Гимназия ?1516 Курсы для школьников / Курсы от школ-партнеров / ГБОУ СОШ ?1159 Курсы для школьников / Курсы от школ-партнеров / ГБОУ Школа ?2065 Курсы для школьников / Курсы от ... Открытые курсы МГУ . ...

Еще в разделе: (Показать все результаты (>107) - distant.msu.ru/ )

• distant.msu.ru: География
• distant.msu.ru: ГБОУ "Школа ?904"
• distant.msu.ru: ННОУ СОШ "Классика"

... It is far easier: to apply for that type of visa one needs a voucher that can be issued by any travel/tourist agency in your home country (but better select an agency recommended by the appropriate Russian Consulate; please note that a hotel reservation even supported by a letter of invitation from the conference organizers is not sufficient to apply for a tourist visa, it is a voucher that is requested). ... 6) After getting the form, one can apply for the Russian visa. ...

Еще в разделе: (Показать все результаты (>52) - www.spa.msu.ru/ )

• Visa support application form
• The 14th International Conference 'Public Administration of the Russian

О факультете . ... 15 марта 2016 года декан биологического факультета Михаил Петрович Кирпичников стал лауреатом премии имени А. А. Баева. ... 27 марта 2016 года, в рамках общеуниверситетского дня открытых дверей, прошел день открытых дверей на биологическом факультете. ... 11- 15 апреля 2016 года на Биологическом факультете пройдет конференция Ломоносов-2106, секция Биология. ... Срок обучения на биологическом факультете в бакалавриате 4 года, в магистратуре 2 года. ... Биологический факультет МГУ . ...

Еще в разделе: (Показать все результаты (>15) - www.bio.msu.ru/ )

• Учебно-научные подразделения ? Биологический факультет МГУ

VISA SUPPORT FORM |Family name| ... Date of | birth | __________________________________ If there is the second (or moreover) citizenship they are specified through a point State of birth ____________________ place of birth _______________________________________ country exact place of birth State of inhabitancy _________________ region___________________________________________ country region in the state of inhabitancy The closest Russian Consulate where you will ask for visa: ...

Еще в разделе: (Показать все результаты (>55) - foroff.phys.msu.ru/ )

• Admission Regulation

TES data processing aims to divide the total field into components and to cancel these, caused by geological noise. The interpretation is fulfilled firstly in 1D variant (in the frame of horizontally-layered model, with IPI-1D package), and then in 2D variant (with IE2DL package). ... This model can be corrected with the help of different transformations for better seeing position and form of the deep objects. ... Two different approaches to the interpretation of profile VES data are possible. ...

Еще в разделе: (Показать все результаты (>73) - geophys.geol.msu.ru/ )

• Software for resistivity and induced polarization
• Near-surface electrical prospecting laboratory at Moscow University
• Researchs

ISSN 0026-2617, Microbiology, 2008, Vol. ... Key words: late stationary phase, secondary growth, Pseudomonas aeruginosa, S and M dissociants, population structure of the culture. ... Growth dynamics and population composition of a mixed culture of P. aeruginosa S and M dissociants in the variant of autolysis in the late stationary phase: optical density, OD з 100 (1); ratio of the M dissociant in the population, % (2); pH (3); and content of reducing sugars, mg % (as glucose) (4). ...

Еще в разделе: (Показать все результаты (>28) - dis.bio.msu.ru/ )

• Именной указатель

... Кафедра нелинейных динамических систем . ... В понедельник, 11 апреля 2016 г., в 18 ч 20 мин, в ауд. 707 состоится очередное заседание семинара. ... Автор: Фурсов Андрей Серафимович 09.04.2016 . В понедельник, 28 марта 2016 г., в 18 ч 20 мин, в ауд. 707 состоится очередное заседание семинара. ... Сотрудники кафедры НДСиПУ, участвующие в 2016 г. в экзаменационной комиссии - Боресков А.В., Краев А.В., Бобылева О.Н., Гончаров О.И., Капалин И.В. Автор: Фурсов Андрей Серафимович 22.02.2016 . ...

Еще в разделе: (Показать все результаты (>30) - ndsipu.cmc.msu.ru/ )

... Davis Center for Russian Studies at Harvard University. The Center aims at developing of fundamental knowledge about Russia, its culture, and its institutions. The Center also examines Russia in its regional and historical context, and welcomes and supports the study of neighboring countries that have been either integrated with, or subordinated to, the Russian state at various periods in history, or whose experience poses intellectual problems similar to those of Russia. ...

Еще в разделе: (Показать все результаты (>13) - suny.msu.ru/ )

• Центр по делам России и США :: Другие проекты в России
• Центр по делам России и США :: СУНИ и ВУЗы России

SVETKA, a program for Analysis of Multiple Sequence Alignments . ... Analyse your alignment . ... Alignment . Nota Bene! .aln or .fasta format required!! Look here for comments . ... Nota Bene! Special scheme format required! ... Development of the program is supported by Ministry of Education and Science of the Russian Federation (State Contract No. ...

Еще в разделе: (Показать все результаты (>4) - mouse.belozersky.msu.ru/ )

• NPG-explorer

... MARINE BIOLOGY Features of the Spatial Distribution of Phytoplankton in Nhatrang Bay of the South China Sea during the Rainy Season L. V. Ilyash and D. N. Matorin Biological Faculty, Moscow State University, Moscow, Russia e-mail: ilyashl@mail.ru Received December 20, 2006; in final form, May 15, 2007 Abstract--The species composition, phytoplankton abundance, and relative yield of the variable fluorescence (Fv /Fm) were determined in the mesotrophic Nhatrang Bay in October­November of 2004. ...

Еще в разделе: (Показать все результаты (>32) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/matorin/3385.pdf

... Absorption lines of neutral and singly ionized metals, blueshifted 50 km s-1 relative to the star, were found. ... The gas temperature of the wind is definitely below 10 000 K, but metals (and probably sulfur) are almost completely singly ionized by strong stellar emission in the hydrogen lines of the Lyman series. ... Conclusions The UV emission spectrum of RW Aur A is strongly disturbed by absorption lines of singly ionised metals originating in the stellar wind. ...

Еще в разделе: (Показать все результаты (>87) - sai.msu.ru/ )

• http://www.sai.msu.ru/dept/adm/lamzin/aa2787.pdf
• http://www.sai.msu.ru/groups/cluster/gcvs/gcvs/iii/vartype.txt
• WORKSHOP "STELLAR ATMOSPHERES" "THE CHEMICAL AND DYNAMIC EVOLUTION OF STARS AND

... Publications . ... Number of publications 0 . ... Borisov A. V. , Kazakov A. O. , Kuznetsov S. P. Nonlinear dynamics of the rattleback: a nonholonomic model . ... A number of strange attractors are considered, for which phase portraits, Lyapunov exponents, and Fourier spectra are presented. ... Borisov A. V., Kazakov A. O., Kuznetsov S. P., Nonlinear dynamics of the rattleback: a nonholonomic model , Physics-Uspekhi, 2014, vol. 184, no. 5, pp. ... Institute of Computer Science Izhevsk, 2005 - 2016 ....

Еще в разделе: (Показать все результаты (>64) - ics.org.ru/ )

... Publications . ... SPDC Laboratory . Quantum Electronics Chair . ... Generation of Polarization Entangled States in Spatially Inhomogeneous Ferroelectrics?, Advanced Science Letters, 2 (4), 430?447 (2009). ... Download [ help ]: . ... Copyright notice: This material is presented to ensure timely dissemination of scholarly and technical work. ... All persons copying this information are expected to adhere to the terms and constraints invoked by each author's copyright. ...

Еще в разделе: (Показать все результаты (>41) - qi.phys.msu.ru/ )

1, 120102 (2012) 2D- - . ... 2D- - E-mail: kozlov@polly.phys.msu.ru 2012 120102-1 [4, 7], . ... 2D- - 1, 120102 (2012) 1D- , x n+1 . ... 5: (), ( ) P () a = 1.9 = 0.1 t = 10000 . ... 2] Kaneko K. Chaos. ... E-mail: kozlov@pol ly.phys.msu.ru In the field of synchronization processes coupled map lattices (CML) represent paradigmatic models of extended systems exhibiting spatiotemporal chaos, self-organization and synchronization due to the rich variety of global qualitative behavior. ... 2012 120102-8 ...

Еще в разделе: (Показать все результаты (>3) - uzmu.phys.msu.ru/ )

• http://uzmu.phys.msu.ru/issue/120103.pdf