... Форумы > Аспирантура > Тема . ... Аспирантура в Порту, Португалия . ... Grant call on E-Careers site: . ... Research Grant . ... Position/ Grant: PhD Research Grant. Generic scientific area: Engineering. ... Location: University of Porto, Faculty of Engineering, Department of Informatics Engineering (FEUP-DEI), http://www.fe.up.pt . ... This PhD research grant requires the completion of a PhD at the Department of Informatics Engineering, Faculty of Engineering, University of Porto (FEUP-DEI). ...

Еще в разделе: (Показать все результаты (>205) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура | PhD position in the University of Florida

... President George W. Bush Department of Education Strategic Goals: Goal One: Create a Culture of Achievement Create a culture of achievement by effectively implementing the president's plan, No Child Left Behind, and by basing all federal education programs on its principles: accountability, flexibility, expanded parental options, and doing what works. ... Goal Six: Establish Management Excellence Create a culture of accountability throughout the Department of Education. ... accountability | ... line...

Еще в разделе: (Показать все результаты (>3) - www.edst.msu.ru/ )

• http://www.edst.msu.ru/conf/docs/Bologne.doc

... The Thickness of Stellar Disks in Early-type Galaxies E. M. Chudakova* and O. K. Sil'chenko ** Sternberg Astronomical Institute, Lomonosov Moscow State University, Moscow, Russia Received August 19, 2013; in final form, October 30, 2013 Abstract--We suggest and justify a new photometric method enabling the derivation of the relative thickness of a galactic disk from the two-dimensional surface-brightness distribution of the galaxy in the plane of the sky. ... The galaxies are non-interacting. ...

Еще в разделе: (Показать все результаты (>50) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/leo3.pdf
• http://sn.sai.msu.ru/~sil/preprints/postbr1.pdf
• http://sn.sai.msu.ru/~sil/preprints/aspb121.pdf

Literature . ... Computers and Statistical Data Analysis. ... In Russian. ... Basic notions and methods of applied statistical analysis and usage of leading Russian and American statistical software tools: STADIA, STATGRAPHICS. ... The second edition has much more detailed depiction of temporal series analysis methods, review of statistical packages for Windows and recommendations on their choosing. ... Kulaichev A.P. Data Analysis Methods And Tools for Windows . ... In English and In Russian. ...

Еще в разделе: (Показать все результаты (>2) - statsoft.msu.ru/ )

• InCo Products Page In English

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Embedded firebird database - вопрос по скорости . ... Написал программу, работающую с Embedded Fireberd. ... Re: Embedded firebird database - вопрос по скорости [ re: zabeyka ] ....

Еще в разделе: (Показать все результаты (>2175) - www.snto-msu.net/ )

• Хоккей ЧМ 2008 - Public forum of MSU united student networks
• Объявления о PhD, Postdoc, Schools, Confs etc. - Public forum of MSU united
• Новинки (аниме, осты, фильмы, дорамы...) - Public forum of MSU united student

... The kinetics of the ESR signal from P700 (ESR signal I) was recorded at different concentrations of exogenous ferredoxin, ,A kinetic model was developed for ferredoxin-dependent cyclic electron transport around photosystem I. A multiparticle model was built to directly describe electron transfer in multienzyme complexes and restricted diffusion of mobile carriers in individual compartments (stroma, lumen, intramembrane space) of the system. ... Ferredoxin Lumen Photosystem I Plastocyanin Fig. ...

Еще в разделе: (Показать все результаты (>39) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/matorin/3414.pdf
• http://library.biophys.msu.ru/PDF/3347.pdf
• http://library.biophys.msu.ru/PDF/3329.pdf

Application of the V--Ray Technology for Optimization of the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D Supercomputers Alexander S. Antonov, Vladimir V. Voevodin Moscow State University, Russia e­mail: voevodin@vvv.srcc.msu.su Abstract The paper shows an application of the so­called V­ Ray Technology for optimizing the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D supercomputers. ... Results for CRAY Y­MP supercomputers. al structure of the program. ...

Еще в разделе: (Показать все результаты (>5) - asa.guru.ru/ )

extra:main ]] . CompHEP . ... Script for including cuts, kinematics, or regularizations into batch.dat file . Script for CompHep cross-sections energy dependence calculation . ... When you done CompHep calculations for the process under study at one energy, you may easely get cross-sections energy dependence running script cs_energy_dep.pl . ... For every energy point the script modifies results/batch.dat file and runs CompHep script num_batch.pl to calculate given process cross-sections. ...

Еще в разделе: (Показать все результаты (>19) - comphep.sinp.msu.ru/ )

• install [CompHEP]
• overview [CompHEP]
• docs [CompHEP]

International Journal for Parasitology 32 (2002) 817-824 www.parasitology-online.com Host manipulation by Ligula intestinalis: a cause or consequence of parasite aggregation? ... Here we consider whether these behavioural changes are important in shaping the distribution of parasite individuals across the fish population. ... Keywords: Ligula intestinalis; Roach; Macroparasitic aggregation; Host manipulation 1. ... Inference of parasite-induced host mortality from distributions of parasite loads. ...

Еще в разделе: (Показать все результаты (>43) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2008_R0r_EcolMod.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2009_Bonferroni_deMeeus.doc
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Dimorph_HumBiol.pdf

Special courses for the students of Physics Faculty, specialized at the Department. ... 32 hours, 6-th term . ... A review of characteristic ferroelectric and magnetic materials is given. ... The anomalies of physical properties in the phase transition in accordance with the crystal symmetry. ... Solid state physics . ... It is assumed that student will get knowledge about magnetic properties of such systems as molecular, clusters, nano-particles, surfaces, ultra thin films, mono- and multilayers. ...

Еще в разделе: (Показать все результаты (>31) - ferro.phys.msu.ru/ )

• Physics Department of Moscow State University
• Department of General Physics and magneto-ordered matter. Physics Department of
• Department of General Physics and magneto-ordered matter. Physics Faculty of

О кафедре . История кафедры . ... Международные и внутри-российские связи кафедры . ... Олимпиада кафедры . Наглядная и компью терная геометрия и топология . ... Дифференциальной Геометрии и Приложений . ... Здесь можно познакомиться с историей кафедры , найти информацию о наших сотрудниках , студентах , аспирантах . ... Имеются различные материалы (в том числе, записки лекций и примеры задач), которые помогут студентам подготовиться к экзаменам и зачетам по курсам, читаемым нашей кафедрой. ...

Еще в разделе: (Показать все результаты (>44) - dfgm.math.msu.su/ )

... 4, No. 5 (2006) 1033­1056 c Imperial College Press RECOGNITION OF TRANSMEMBRANE SEGMENTS IN PROTEINS: REVIEW AND CONSISTENCY-BASED BENCHMARKING OF INTERNET SERVERS NATALIYA S. SADOVSKAYA Institute for Information Transmission Problems, Russian Academy of Science Bolshoi Karetny per. ... Landolt-Marticorena C, Williams KA, Deb er CM, Reithmeier RA, Non-random distribution of amino acids in the transmembrane segments of human typ e I single span membrane proteins, J Mol Biol 229(3):602­608, 1993. ...

Еще в разделе: (Показать все результаты (>9) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/bmc_genom2_2013.pdf
• http://storage.bioinf.fbb.msu.ru/~roman/Sutormin_CV_aug2014.pdf
• http://storage.bioinf.fbb.msu.ru/~roman/bmc_genom_2013.pdf

Prof. A.Nekipelov Moscow School of Economics , Moscow State University Lomonosov The Concepts of Economic Growth and Economic Development: Standard Macroeconomics and Pure Economics Approaches A Lecture Presented on January 31, 2011 at the International School f or Students Organized by IASSA and Department of Computational Mathematics and Cybernetics, MSU Lomonosov Economic Growth and Its Measurement by ... This distinction is applicable to the field of economic investigation. ...

Еще в разделе: (Показать все результаты (>23) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/Nekipelov_France_2010_Slides_Eng.pdf

... История кафедры . ... младших курсов . ... Уважаемые студенты 1-го, 2-го и 3-го курсов! ... Семинар кафедры проходит по пятницам в 15.20 в комн. ... а также на стендах кафедры на 2-м и 4-м этажах. Информацию о более ранних событиях см. в разделе "Жизнь кафедры" . ... 119991, Москва, Ленинские горы, д.1, стр.2, МГУ имени М.В.Ломоносова, физический факультет, кафедра фотоники и физики микроволн . ...

Еще в разделе: (Показать все результаты (>2) - photonics.phys.msu.ru/ )

• Department of Photonics and Microwave Physics - Faculty of Physics of Lomonosov

... Поздравляем профессора кафедры М.А.Носова с присуждением ему премии международной академической издательской компании Наука/Интерпериодика за лучшую публикацию в издаваемых ею журналах! . 02.11.2015 . 11-13 ноября 2015 г. в ИПМех РАН пройдет Международная научная школа молодых ученых Физическое и математическое моделирование процессов в геосредах . ... Интервью зав. кафедрой К.В.Показеева: . 2002-2016, Кафедра физики моря и вод суши . ...

Еще в разделе: (Показать все результаты (>15) - ocean.phys.msu.ru/ )

... N 3 Contents Anthropology Goodkova L.K. The value of works of Y.Y. Roginsky for the development of physiological anthropology (p. 4-9) The works of Y.Y. Roginsky on variability, correlation and integrity were of great importance for the development of physiological, ecological, anthropology. ... Race of the child is also mentioned as a possible factor. Y. Roginsky was particularly interested in age changes of different anthropometric and anthroposcopic traits in children of different ethnicities. ...

Еще в разделе: (Показать все результаты (>28) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2013_1.doc
• http://www.antropos.msu.ru/vestnic/e2013_3.doc
• http://www.antropos.msu.ru/vestnic/e2015_1.doc

Magnetism Department MSU . ... Education . ... Process of education on magnetism division . ... Different courses on classical theory of magnetic phenomena and on actual problems of modern theory of magnetism are read on magnetism division. ... Students of magnetism division do practical work on the 8th term with more then 50 students from other divisions each year. ... Physics of semiconductors division . ... oblig. – alt. ... Alexander Shaligin, associate prof. assessment . ... oblig. 519, 505 . ...

Еще в разделе: (Показать все результаты (>955) - magn.phys.msu.ru/ )

• Some materials

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

The opinion of the members of the Russian Rectors ' Union delegation of the results of the Fourth All- Russian Students ' Forum The Vice-president of the Russian Rectors ' Union, Chairman of the Council of Rectors of higher educational institutions of the Siberian Federal District and the Novosibirsk region, Rector of Novosibirsk State Technical University N.V. PUSTOVOY: The participation of the Russian ...

Еще в разделе: (Показать все результаты (>31) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/2012_09_18/3.pdf
• http://www.rsr-online.ru/doc/norm/273.doc

... Research objects and scientific purposes . Space scientific program includes development and launch of two supersmall spacecrafts "Universitetskiy" and "Kompas-2" intended for monitoring of radiation conditions near the Earth. ... All the studies conducted in the near-Earth space are characterised by strong radiation fields. ... The circular polar orbits, which cover all the near-Earth space, are the most favorable for comprehensive studies of the radiation conditions near the Earth. ...

Еще в разделе: (Показать все результаты (>73) - cosmos.msu.ru/ )

• Новости