Technical aspects of the search for anomalous Wtb couplings. ... Outline What we call anomalous Wtb couplings Operators and vertex approaches Anomalous couplings in production cross section Anomalous couplings in the decay of top quark Effective operators in the field theory: In the units where = c = 1, the fields of the SM have mass dimensions: scalar: vector: fermion: Every term ... Problems of vertex function approach: We use operators with different mass dimensions. ...

Еще в разделе: (Показать все результаты (>159) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2013/POZDEEVAQFTHEP13.pdf
• http://qfthep.sinp.msu.ru/talks/qfthep10_levchenko.pdf

... Radical changes in the life of the country at the end of the twentieth century put the Moscow University within the need of maintaining a high level of classical university education in the new environment. ... In June 2006 the Academic Council of the Moscow State University has decided to establish a new Faculty - Higher School of Management and Innovation (Corporate University) - jointly with JSFC "Sistema" . ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>28) - hsmi.msu.ru/ )

• Admission committee | MSU Higher school of management and innovation
• School overview | MSU Higher school of management and innovation
• MSU Higher school of management and innovation |

Host: localhost Database: atomax2 --------------------------------------------------------- -- Server version 3.23.52-nt -- -- Table structure for table ' deliveries ' -- DROP TABLE IF EXISTS deliveries ; CREATE TABLE deliveries ( id_delivery int (11) NOT NULL auto_increment, subj varchar( 255 ) default NULL , author varchar( 255 ) default NULL , type tinyint (4) default ...

Еще в разделе: (Показать все результаты (>7) - textbook.sinp.msu.ru/ )

• http://textbook.sinp.msu.ru/modules/ax_visitors/visitors.mysql
• http://textbook.sinp.msu.ru/modules/ax_visitors/visitors.sql

... MSU Chamber Orchestra . ... Chamber Orchestra of Moscow State University was born in 1967. ... It was originally formed as a chamber orchestra at the School of Mathematics and Mechanics but soon (since September 1967) transformed into a Chamber Orchestra of the Moscow State University. ... The Chamber Orchestra of Moscow State University won the first prizes in the 1-st and 2-nd All-Union festivals of non-professional arts. ... Moscow State University does not have its own School of Music. ...

Еще в разделе: (Показать все результаты (>81) - music.genebee.msu.ru/ )

Site navigation: . ... Publications . ... SPDC Laboratory . ... This website uses Javascript for many elements such as the menus and page customization. ... Using a clever design of polarization optic, Italian researchers have successfully created four-level 'ququart' quantum states using the polarization and orbital angular momentum of single photons. ... All persons copying this information are expected to adhere to the terms and constraints invoked by each author's copyright. ...

Еще в разделе: (Показать все результаты (>137) - qi.phys.msu.ru/ )

... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...

Еще в разделе: (Показать все результаты (>2) - www.ccl.msu.su/ )

... Conferences . ... http://gct.math.nsc.ru/?event=metric-structures-and-control-systems . International Conference METRIC STRUCTURES AND CONTROL SYSTEMS will take place in Sobolev Institute of Mathematics, Novosibirsk, Russia, December, 17 ? ... The conference is organizing by the Laboratory of Geometric Control Theory of the Sobolev Institute of Mathematics (SB RAS) within the framework of the Project ?Geometric Control Theory and Analysis on Metric Structures?. ...

Еще в разделе: (Показать все результаты (>214) - ics.org.ru/ )

• Institute of Computer Sciences - Publications
• Institute of Computer Sciences - Conferences

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>27) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus

Psychology in Russia: State of the Art Volume 6, Issue 1, 2013 Russian Psychological Society Lomonosov Moscow State University The role of television in cultivating the values of pluralism and cultural diversity in children Anna A. Gladkova Lomonosov Moscow State University, Moscow, Russia This article examines the influence of the mass media and in particular television on the development of the values of pluralism and cultural diversity in children. ... Television & the Cultivation of Values. ...

Еще в разделе: (Показать все результаты (>164) - www.psy.msu.ru/ )

• http://www.psy.msu.ru/people/nurkova/nurkova2004b.pdf
• http://www.psy.msu.ru/science/psyrussia/2013-3/2013_3_49-59.pdf
• http://www.psy.msu.ru/science/psyrussia/2013/vartanova.pdf

Submission Instructions Please read all instructions before completing the form. ... Name: | ... Name Phone | ... No Yes |( ... Are written and dated laboratory records and data available? ... Please provide date of defence or anticipated date of defence. ... Was the invention created using confidential information of a third party? ... result in similar information no longer being supplied to the University when | ... Inventor's signature(s) (if selecting option A, | ... Print Name Signature | ...

Еще в разделе: (Показать все результаты (>28) - innovation.msu.ru/ )

• Start-Up Company Development :: Управление инновационной политики и организации

... ОТЧЕТЫ СТУДЕНТОВ О ПРАКТИКЕ В САО . Лето 2001 года . ... Гришатовой Юлии . ... Для определения лучевых скоростей, FWHM (полной ширины на половине максимума) и интенсивности линия He I 6678.15А описывалась гауссианой ( рис.1 ). ... create/icat {P1} ztsh*.bdf . execute/catalog @@ set_lambda {P2} . execute/catalog @@ timing {P2} . execute/catalog @@ phase {P2} . ... create/table {P1}.tbl . ... create/column {P1}.tbl fwhm . execute/catalog @@ add_rv_curve_point {P2} {P1}.tbl . ...

Еще в разделе: (Показать все результаты (>14) - heritage.sai.msu.ru/ )

... Программы обучения . ... Пропустить категории курсов . ... Пропустить новости . ... от Администратор ЦДО Ф/Ф МГУ - Понедельник 4 Август 2014, 09:53 . 04 августа 2014 года в Интеллектуальном центре ? ... Российские ВУЗы все чаще переходят на дистанционное обучение . ... ДИСТАНЦИОННЫЕ ПОДГОТОВИТЕЛЬНЫЕ КУРСЫ ФИЗИЧЕСКОГО ФАКУЛЬТЕТА МГУ ПО ФИЗИКЕ И МАТЕМАТИКЕ Пропустить Страницы ЦДО в социальных сетях . ... Центр дистанционного образвания физического факультета МГУ им. М.В. Ломоносова 2007-2012 . ...

Еще в разделе: (Показать все результаты (>53549) - distant.phys.msu.ru/ )

• Уведомление

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>5) - sinp.msu.ru/ )

... Download NPG-explorer . ... Build nucleotide pangenome . ... Here we provide a table for 3 Brucella genomes: all: embl :CP002459 BRUMM chr1 c Brucella melitensis M28 chromosome 1 all: embl :CP002460 BRUMM chr2 c Brucella melitensis M28 chromosome 2 all: embl :CP003176 BRUAO chr1 c Brucella abortus A13334 chromosome 1 all: embl :CP003177 BRUAO chr2 c Brucella abortus A13334 chromosome 2 all: embl :CP002078 BRUPB chr1 c Brucella pinnipedialis B2/94 chromosome 1 all: ... Fix bugs....

Еще в разделе: (Показать все результаты (>6965) - mouse.belozersky.msu.ru/ )

• Geometrical core

... Scientific educational events were organized at the Chair and the Faculty in the framework of the All-Russian School RESEARCH AND EDUCATIONAL PROJECTS on Global Social and Natural Processes in Interdisciplinary AND ACTIVITIES Studies as a joint action with the MSU Youth Council on Federal Task Program aimed at the inclusion of young Scientific research studies done by students of people in the scientific educational innovation processes the Chair and the Faculty were praised at the in Russia. ...

Еще в разделе: (Показать все результаты (>79) - fgp.msu.ru/ )

• Search Results п¤п“пџ пњп“пе пёпј. пњ.п’. п›пѕпјпѕпЅпѕяЃпѕпІп°

International Laser Center of MSU . Home . ... Education . ... 06.10.2014 . October 10, 2014 . 15:00 S.A. Akhmanov Hall, KNO . ... 20.09.2009 . 3-d International Laser Graduate School "Modern Problems of Laser Physics LGS-2009 " . ... 15:00 S.A. Akhmanov Hall, Nonlinear Optics Bld. ... Home Science and education Papers . ... Abstract: The potentially attainable information capacity of a radiatively stable lambda-system, viewed as the input of a quantum information channel, is studied. ...

Еще в разделе: (Показать все результаты (>130) - ilc.phys.msu.ru/ )

... Winner of joint DAAD (German Academic Exchange Service) and Moscow State University Scholarships Program ?Vladimir Vernadskii? for joint research in Germany. 2011-present. ... 16.11-12.12.2009, Collaborative Research Center 701 of Bielefeld University, Bielefeld, Germany. ... Another ham sandwich in the plane? (joint work with Alexey Balitskiy and Roman Karasev from Moscow Insitute of Physics and Technology), November 9, 2013, Kolloquium Kombinatorik, TU Ilmenau, Ilmenau, Germany. ...

Еще в разделе: (Показать все результаты (>205) - higeom.math.msu.su/ )

• Publications (English)
• Publications (Russian)
• S.P.Novikov Seminar

... Electronic journal Issue 4. 10 september 2004 Leigh E. Making Learning a Game Introduction. As a university lecturer I enjoy playing games with learning goals in mind. My students are all adults who work in many different roles. ... Their needs include learning how to design activities that will support acquisition of practical skills, extend personal understanding of emotional factors, and improve awareness of factors ­ such as economic, ecological and political aspects of society. ... Play. ...

Еще в разделе: (Показать все результаты (>9) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf

... Carbamide . ... Moscowљ? ... URALCHEM and Stamicarbon will develop a new technology for urea production . URALCHEM, a leading Russian producer of nitrogen fertilizers, signed a joint technology development agreement for the synthesis of urea with Stamicarbon, the world's top developer and licensor of urea processes. ... Laboratory of Chemical Thermodynamics љwasљestablished by Prof. Adam V. Rakovsky (corresponding member of USSR Academy of Sciences) first as a "halurgy laboratory" in 1930. ...

Еще в разделе: (Показать все результаты (>92) - td.chem.msu.ru/ )

• Colloquium on 23.12.10 Laboratory of Chemical Thermodynamics
• Research Areas Laboratory of Chemical Thermodynamics
• Colloquium on 07.12.12 Laboratory of Chemical Thermodynamics

... Keywords: anthropology, craniotrigonometry, skull angular morphometry, the Russian Imperial Romanov family, shaping angles parameters Sviridov A.A. Cranial study of population of Loyalty Islands (Melanesia) (p. 88) The aim of this work is to study cranial series of 67 skulls from the Loyalty Islands (Northern Melanesia), stored at Musee de l'Homme (Paris, France). ... The study of intragroup variability showed a difference in the cranial types of the population of the Lifou and Mare islands. ...

Еще в разделе: (Показать все результаты (>27) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2014_1.doc
• http://www.antropos.msu.ru/vestnic/e2013_1.doc
• НИИ и Музей антропологии | Вестник Московского университета. Серия XXIII.