... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

... 209 ­ 212 209 THE ROLE OF THE NATIVE POND ODOR IN ORIENTATION OF THE GREEN TOAD (Bufo viridis LAUR.) YOUNGS-OF-THE-YEAR V. V. Shakhparonov1 and S. V. Ogurtsov 1 Keywords: toadlets, orientation, native pond odor, buffer zone, periods of learning. ... Individuals from the "buffer" zone prefer the native pond water during a week before the beginning of dispersal (as described by a distribution stability coefficient S; Fig. ... The latter are, probably, individuals ready for dispersal. ...

Еще в разделе: (Показать все результаты (>85) - vertebrata.bio.msu.ru/ )

• Student Reports at International Conferences
• Выступления студентов и аспирантов на конференциях

... Widgetkit is the next generation tool set for Joomla and WordPress. ... All widgets make use of modern web technologies like HTML5 markup, CSS3 features and jQuery based JavaScripts. ... It supports touch gestures and makes use of smooth CSS3 animations. ... Semantic HTML5 markup . ... You can create, edit or delete all widgets and their content in one place. ... escort beylikduzu bayan escort escort bayan escort escort istanbul escort bayan porno film escort istanbul escort beylikduzu escort bayan ...

Еще в разделе: (Показать все результаты (>5) - physcontrol.phys.msu.ru/ )

HERMITE FUNCTIONS EXPANSION BASED NON-LOCAL MEANS ALGORITHM FOR CT-APPLICATIONS1 N. Mamaev2, A. Lukin3, D. Yurin4, M. Glazkova5, V. Sinitsin6 Laboratory of Mathematical Methods of Image Processing Faculty of Computational Mathematics and Cybernetics Lomonosov Moscow State University Leninskie Gory, Moscow 119991, Russia mamaev.nikolay93@mail.ru, 3lukin@ixbt.com, 4yurin@cs.msu.ru 5,6 Federal Center of Medicine and Rehabilitation Ivan'kovskoye sh., ... Noise in CT-images is close to Gaussian [3]. ...

Еще в разделе: (Показать все результаты (>18) - imaging.cs.msu.ru/ )

• http://imaging.cs.msu.su/~yurin/2008.astr.Yurin_Kravtsov.script.ru.pdf

NEW ECONOMIC SCHOOL .. BSP/2007/094 R 2007 " " .. ... On The Dynamics of People's Unions / Working Paper # BSP/2007/094 R. - Moscow, New Economic School, 2007. - 19 p. (Rus.) ... Key words: public economics, allocation theory, size of nations ISBN ї .. ... x[0,1] - (FOC) FOC: (W1 (x) + W2 (1 - x)) = 0, x (1) - (SOC) SOC: 2 (W1 (x) + W2 (1 - x)) 0. x2 (2) , (1) (2), .. ... Grossman & Mendoza, 2001, 2004) , , , : , . ... On the Number and Size of Nations", Quarterly Journal of Economics Vol. ...

Еще в разделе: (Показать все результаты (>11) - belyakov.imec.msu.ru/ )

• http://belyakov.imec.msu.ru/papers/SPbGTU2003.pdf

Funding of applicants from non-EU countries & international organisations Version 1.0 14 February 2014 Cooperation with participants from third countries and international organisations Horizon 2020-Open to the world! ... They are not always automatically entitled to funding. ... 3 Cooperation with participants from third countries and international organisations Additionally, any applicant based in a country which is Associated to Horizon 2020 is automatically eligible for funding. ...

Еще в разделе: (Показать все результаты (>35) - ideas.msu.ru/ )

• http://www.msu.ru/int/newpr/7ram/7ram_prez.pdf
• http://www.msu.ru/int/newpr/7ram/7ram_info.pdf
• http://ideas.msu.ru/docs/press_release_2012.doc

... Executing config_lcgenv Executing config_java Executing config_ glite _tar_ui gLite Security Utilities configuration successfully completed xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Configuring the gLite R-GMA Client xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Checking configuration values [ OK ] Verifying the / gLite / glite / etc ... Configuring BDII based Service Discovery [ OK ] Configuring R-GMA based Service Discovery .. ...

Еще в разделе: (Показать все результаты (>3) - lhe.sinp.msu.ru/ )

BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...

169. Quantum Information Lab, Int'l Laser Ctr. and Faculty of Physics, M.V.Lomonosov

170. School overview | MSU Higher school of management and innovation

171. Аспирантура (Ph.D.) в Large Lakes Observatory (University of Minnesota) |

172. http://pont2008.cs.msu.ru/files/en/abstracts/Arnold.pdf

173. http://www.msm.biophys.msu.ru/archive/doc14950/eng.pdf

174. EUROMECH Colloquium-458

175. The Ecological Cooperation project is the first large scale childrenтАЩs

176. http://www.sai.msu.su/gcvs/gcvs/nl74/readme

177. Ботанический сад Московского университета

178. Department of the Composites Mechanics

179. http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=4&subtheme=13&from=0&ref_ind=0207000019

180. http://hit-conf.imec.msu.ru/2012/lectures/Chernyshenko.doc