... About 70 scientific papers. The theory of square parachute is created, describing distribution of parameters of shape, tension and resistance to airflow of canopy in steady-state condition for various sets of suspension line lengths and air-permeability. ... The practical recommendations for optimal parachute application are submitted. ... It is discovered experimentally that a character of pressure distribution for a square canopy depends on a particular choice of suspension line lengths. ...

Еще в разделе: (Показать все результаты (>7) - margaret.imec.msu.ru/ )

... Conferences . ... International Conference "V Bredikhin Reading 2014", Zavolzhsk, Russia, May 12-16, 2014 (L.A. Egorova). 5th European Conference for Aeronautics and Space Sciences - EUCASS 2013, Munich, Germany, July 1-5, 2013 (V.I. Sakharov). International Conference "Near Earth Astronomy-2013", Agoy, Krasnodar region, Russia, October 7-11, 2013 (L.A. Egorova). ... International Meteor Conference 2012, La Palma Island, Canary, Spain, September 20-23, 2012 (L.A. Egorova). ...

Еще в разделе: (Показать все результаты (>11) - lab106.imec.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• ConClus

... Студенческая Астрономическая обсерватория ГАИШ . ... Любителям астрономии . История ГАИШ и Московской обсерватории . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... Welcome to the Extra-galactic research group of SAI ! ... Sternberg Astronomical Institute is older than the entire field of extra-galactic astronomy. ... At the same time, the Extra-galactic astronomy group as an element of the institute structure remains the youngest subdivision of SAI. ... 2007, astro-ph/0709.3047 . ...

Еще в разделе: (Показать все результаты (>34) - www.sai.msu.ru/ )

A.Nekipelov Modernization of Basic Research in Russia: Russian Academy of Sciences ( RAS ) Vision Joint Session of Russian Academy of Sciences, Institute of France Academy of Sciences and Academy of Technology of France Paris, 2010, September 28 1 RAS in Russian Basic Science Potential (per cent, 2008) Russian Federation Research Organizations 100,0 RAS 12,7 Overall Personnel ... Who is the main actor in research: an institute or a laboratory? ...

Еще в разделе: (Показать все результаты (>27) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/sc_pub/ushkalova_sc_pub_2010_en.pdf
• http://www.mse-msu.ru/Bassanini_Mosca_rev4.pdf
• http://www.mse-msu.ru/RAS_Resolution.pdf

Journal Search . Welcome to the Search Page. You can find publications of our laboratory here. ... 1.Author . All Bochenkova A.V. Dobrogorskaya Ya.I. Ermilov A.Yu. Firsov D.A. Granovsky A.A. Grigorenko B.L. Moskovsky A.A. Nemukhin A.V. Skasyrskaya E.Ya. ... J. Phys. Chem.Phys.Lett. ... J.Chem. ... Science J.Chem. ... Theochem) J.Phys.Chem.A J.Phys.Chem.B Mendeleev Communications Molec.Phys. Phys.Rev.B Russian J. of Phys. Chem. ... All 2002 2001 2000 1999 1998 1997 1996 1995 1994 . ...

Еще в разделе: (Показать все результаты (>19) - lcc.chem.msu.ru/ )

• Current Projects
• Laboratory of Chemical Cybernetics

.

Еще в разделе: (Показать все результаты (>76) - lav01.sinp.msu.ru/ )

... Take latest Pacman and install it : Create somewhere directory software/ and simply untar Pacman there : cd software wget http://physics.bu.edu/pacman/sample_cache/tarballs/pacman-latest.tar.gz tar xzf pacman-latest.tar.gz # It will be created, for example, directory pacman-3.21/ rm -f pacman-latest.tar.gz ln -s pacman-* pacman cd pacman source setup.csh # or setup.sh cd .. ... For instance, if you do pacman -allow tar-overwrite this setting remains as a default until you change it. ...

Еще в разделе: (Показать все результаты (>12) - lhe.sinp.msu.ru/ )

• LHPR Homepage

List of available DNA-protein and RNA-protein complexes . List of Pfam domains presented in DNA-protein and RNA-protein complexes . List of SCOP domains presented in DNA-protein and RNA-protein complexes . ... Amino acid code changer : 3-letter code to 1-letter code and vice versa . The work is supported by the Russian Foundation of Basic Research, grants 06-07-89143 and 06-04-49558, and INTAS, grant 05-1000008-8028 ...

Еще в разделе: (Показать все результаты (>151) - monkey.belozersky.msu.ru/ )

• About this project
• PDB entries containing domains of the family "Sigma-70, region 4"
• PDB entries containing domains of the family "Basic region leucine zipper"

... I would like to invite you to visit my website http://www.againstchance.webs.com/ where I present the demonstration of my invention, the device for predicting the Future. It is a computer program which reveals the reaction of the computer to the future creation of a file, and since the command to create a file can be given to the computer in accordance with the outcome of any external event, such a reaction can predict that event, too. ...

Еще в разделе: (Показать все результаты (>18) - temporology.bio.msu.ru/ )

• A FREGIMO AMISSA - Научный адъ

Вход в личный кабинет . ... Ярмарка вакансий и стажировок для студентов и выпускников вузов . Новости науки и техники События . ... Подписаться на новости . Вакансии . ... Компания: Nielsen company . The Nielsen Company is a market-leading information & media company with more than 41,000 employees in 100+ countries around the world. ... Please send your CV before June 9th marked in Subject line Summer Internship Program at: RussiaMoscow.HR@nielsen.com or info.russia@nielsen.com . ...

Еще в разделе: (Показать все результаты (>58) - www.physcareer.ru/ )

• Ведущий разработчик Oracle Forms / Вакансии / Physcareer.ru

Contemporary media environment is formed by dense concentration and interaction of cultures, languages, channels and modalities of communication. ... Across this new terrain, rich, exciting and risky, the new generation of media practitioners, teachers, researchers and public intellectuals is expected to navigate competently and creatively. ... Nor can the idea of intercultural communication be limited (as it was тАУ only recently) to relatively formal contact between established national cultures. ...

Еще в разделе: (Показать все результаты (>11) - discours.philol.msu.ru/ )

• Summer School 2016
• Anna Kotomina

... Information on your customer account . ... Brazil British Indian Ocean Territory Brunei Darussalam Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote D'Ivoire Croatia Cuba Cyprus Czech Republic Denmark Djibouti Dominica Dominican Republic East Timor Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland...

Еще в разделе: (Показать все результаты (>70) - www.bukivedi.ru/ )

... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...

Еще в разделе: (Показать все результаты (>8) - vernov-relec.sinp.msu.ru/ )

... Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. ... Lorem ipsum dolor sit amet, consetetur sadipscing elitr. ... Lorem ipsum dolor sit amet. Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. <div class="myclass">...</div> . ... Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna. ...

Еще в разделе: (Показать все результаты (>8) - physcontrol.phys.msu.ru/ )

• Icons
• Widgetkit

BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...

Еще в разделе: (Показать все результаты (>4) - muscle.imec.msu.ru/ )

... Главная Факультет политологии Новости факультета Новость . ... На заседании Ученого совета факультета политологии МГУ состоялось торжественное вручение сертификата призеру международного конкурса эссе на английском языке ?Creating the Future We Want?. Декан факультета политологии профессор А. Ю. Шутов поздравил студента III курса Павла Воробьева и вручил ему от имени организаторов конкурса сертификат за глубокое понимание и раскрытие темы. ... Поступление на факультет политологии в 2016 году . ...

Еще в разделе: (Показать все результаты (>21) - polit.msu.ru/ )

• Новости факультета

... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...

Еще в разделе: (Показать все результаты (>164) - www.pereplet.ru/ )

... Institute of Nuclear Physics, . ... I have been directly involved in theoretical and phenomenological analysis -- within the D? collaboration -- devoted to a search for single top quark production in the electroweak processes. ... 1] B. Abbott et al. ... D0 Collaboration], ``Inclusive jet production in p anti-p collisions,'' hep-ex/0011036. ... D0 Collaboration], ``Search for electroweak production of single top quarks in p anti-p collisions,'' hep-ex/0008024. ... Phys.Rev.Lett. ...

Еще в разделе: (Показать все результаты (>9) - top.sinp.msu.ru/ )

... about ERC . education . research . events . ... Being an effective way of acquiring knowledge, they also make a good addition to core lecture courses and involve students, postgraduates and scientists of other Russian higher education institutions and research centers in ERC activity in the initial stage. ... More information can be found at http://polly.phys.msu.ru/ru/unc/sconf.html . ... Conference on Development Prospects of Education and Research Centers in the Russian Federation . ...

Еще в разделе: (Показать все результаты (>18) - nano.msu.ru/ )