ChangeLog for / # # Generated by Trac 0.12.5 # 04/11/16 21:39:53 Sat , 04 Dec 2010 21:16:12 GMT darkhan [24:e368337edc67] * Automata.py ( modified ) Correction in Automata Sat , 04 Dec 2010 20:44:37 GMT darkhan [23:c74a9885bf04] * Automata.py ( modified ) * State.py ( modified ) Comment in English Sat , 04 Dec 2010 20:39:27 GMT darkhan [22:749533cdfc67] * State.py ( ...

Еще в разделе: (Показать все результаты (>236) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=24%3Ae368337edc67&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=c74a9885bf048a4938c290470e671c1c9c68dd33&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=23%3Ac74a9885bf04&limit=100&mode=stop_on_copy

Dear Sergey Shakin: Per mit me to comment on the accusations br ought against Academician Nekipelov, which I read on the site of Polit.ru. In the first place, it is clear that the editors, having r equested an "academic" r eview of the Nekipelov book, have stretched and abused the comments by Professor Sonin. ... The other matters -- for instance whether ther e is too much citation for a monograph -- are entir ely subjective, matters basically of academic taste. ...

Еще в разделе: (Показать все результаты (>22) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/sc_pub/presman_sc_pub_2011.pdf

MASS Software Version 2.04 User Guide V.Kornilov, N.Shatsky, O. Voziakova Decemb er 30, 2003 Contents 1 MASS software op eration overview 1.1 Main features of measurement pro cess with MASS instrument . ... 2 Installation, tuning and startup 2.1 Installation of the MASS software Turbina 2.2 Editing the configuration file . ... 4.2 Output data in MASS Software . ... 4.2 Output data in MASS Software The output of Turbina program op erating the MASS device is directed to an ASCI I file called mass-file. ...

Еще в разделе: (Показать все результаты (>23) - curl.sai.msu.ru/ )

• http://curl.sai.msu.ru/mass/download/doc/massug_eso.pdf
• http://curl.sai.msu.ru/mass/download/doc/pmt_param_eng.pdf
• http://curl.sai.msu.ru/mass/download/doc/infrasoft_eng.pdf

... Конкурс У.М.Н.И.К. Объявления . ... Лучший молодой ученый года иљ . ... Конкурс научных работ молодых ученых МГУ (?Конкурс СМУ 2016?) Объявлен 40-й Конкурс научных работ молодых ученых МГУ, проводимый СМУ МГУ.љ ... 20 октября 2016 г. состоится полуфинальная конференция У.М.Н.И.К. 20 октября 2016 г. (ориентировочная дата) на Физическом факультете МГУ љ состоится полуфинальная конференция на получение премии поддержки молодых ученых У.М.Н.И.К. љ 20 октября 2016 г. состоится полуфинальный .. ...

Еще в разделе: (Показать все результаты (>4) - smu.physics.msu.ru/ )

... О хоре . История хора . ... Выступление Академического хора МГУ в Крокус Сити Холле . ... Епископ Тихон открыл выступление хора МГУ в Вене . Хор МГУ выступил в Венском отделении ООН . Выступление хора на торжественном открытии Международного научного конгресса ?Глобалистика ? 2015? ... Академический хор Московского государственного университета имени М. В. Ломоносова . ... Прослушивания состоятся в течение всего сентябряљв 311 и 316 классах Культурного центра МГУ в 18-30 . ...

Еще в разделе: (Показать все результаты (>2) - choir.msu.ru/ )

... About CIE MSU . ... Vestnik CIE (in Russian) . ... About Moscow University . ... The CIE provides tuition in Russian in accordance with the course of study and study programmes depending on the chosen subjects, goals, and forms of study as stated in the student s contract. ... Also the students can use the library, audio collections, video- and computer classes of the Center. ... Students are expected to attend classes, complete academic assignments, observe the University rules and regulations. ...

Еще в разделе: (Показать все результаты (>12) - www.cie.ru/ )

• Apply Online
• Enrollment :: Admissions :: CIE

... Int'l Laser Center and Faculty of Physics . M.V.Lomonosov Moscow State Univ. Moscow 119899 . ... Welcome to the website of Quantum Information Laboratory at M.V.Lomonosov Moscow State University , affiliated with the International Laser Center and the Faculty of Physics . ... The Quantum Information Lab offers 2nd year students of Physics a number of projects that can be performed within the frame of our laboratory. ... 2016 Quantum Information Laboratory. ...

Еще в разделе: (Показать все результаты (>57) - qilab.phys.msu.ru/ )

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... President George W. Bush Department of Education Strategic Goals: Goal One: Create a Culture of Achievement Create a culture of achievement by effectively implementing the president's plan, No Child Left Behind, and by basing all federal education programs on its principles: accountability, flexibility, expanded parental options, and doing what works. ... Goal Six: Establish Management Excellence Create a culture of accountability throughout the Department of Education. ... accountability | ... line...

Еще в разделе: (Показать все результаты (>3) - www.edst.msu.ru/ )

УДК 57.087.2:519.233.3 On the power of some binomial modifications of the Bonferroni multiple test ї2007 A. T. TERIOKHIN, T. DE MEEшS, J.-F. GUиGAN Genetique et Evolution des Maladies Infecrieuses, UMR 2724 IRD-CNRS, Centre IRD ... University Leninskie Gory 1, Moscow 119992, Russia e-mail: terekhin_a@mail.ru Widely used in testing statistical hypotheses, the Bonferroni multiple ... The power of tests for [pic] under the alternative hypothesis that all partial null hypotheses are false | ...

Еще в разделе: (Показать все результаты (>19) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2000_Fecundity_ProcRoySoc.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2009_Bonferroni_deMeeus.doc
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Birthweight_JEvolBio.pdf

... Наши профессиональные области: прикладная статистика, анализ сигналов и контроль процессов биологической и физической природы, история, философия, религия и др. ... Прочие же антропометрические показатели автора крайне заурядны и не представляют абсолютно никакого исследовательского интереса. см. также: Внатуре Арийская генеалогия Мастера . ... CONAN-t - Integrated Computer Series for Frequency Analysis, Control and Automation over Processes in Industrial and Technical Applications . ... Download . ...

Еще в разделе: (Показать все результаты (>8) - www.protein.bio.msu.ru/ )

... High Brightness RTM . ... Techniques to generate short, small emittance electron bunches of several nC at energies of several MeV are being developed to drive free electron lasers, for accelerator research, to provide short laser Thomson scattering X-ray pulses, and to generate intense coherent millimeter radiation (e.g., synchrotron, transition, etc.) ... Generating several tens of MeV beams now requires large, expensive, energy inefficient accelerators available only at large laboratories. ...

Еще в разделе: (Показать все результаты (>3) - vserv.sinp.msu.ru/ )

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... This section presents the results of the application of the methodology described in the previous section to real EEG signal. ... Fig. 7.1. Detection algorithm adapted for the EEG analysis . The EEG (a) was filtered in the alpha band (bandpass 7.5--12.5 Hz) (b) and then the amplitude squared (c); the result is the sequence from which the subintervals are cut out at further steps. ...

Еще в разделе: (Показать все результаты (>42) - brain.bio.msu.ru/ )

• Non-stationarities in EEG. Methods of segmentations of the EEG signal
• Unsolved problems and new prospects

... Полная версия: Не могу найти тему с картинкофлудом . Грация-МГУ::Форум > Общение > Общение . ... Feb 1 2008, 12:45 . ... Mar 5 2008, 12:30 . ... http://news.online.ua/2008/03/05/1056578914.php . ... Нажмите для просмотра прикрепленного файла . ... Apr 2 2008, 23:00 . ... Jun 15 2008, 09:34 . ... А если найду?" (с) . ... Jul 18 2008, 23:15 . ... Sep 8 2008, 12:17 . ... Цитата(Reaper @ Sep 12 2008, 23:31) . ... Для просмотра полной версии этой страницы, пожалуйста, нажмите сюда . ...

Еще в разделе: (Показать все результаты (>31) - grace.msu.ru/ )

• Грация-МГУ::Форум > Учимся водить машину
• Не могу найти тему с картинкофлудом - Грация-МГУ::Форум
• Учимся водить машину - Грация-МГУ::Форум

... История лаборатории КГЭ . Лаборатория КГЭ сегодня . ... Информация для студентов 1-3 курсов . ... This is Lotus Flower, is a free template from Free CSS Templates released under a Creative Commons Attribution 2.5 License . ... Phasellus tellus turpis, iaculis in, faucibus lobortis, posuere in, lorem. ... Vivamus varius justo sit amet leo. ... Nam cursus, orci sit amet porttitor iaculis, ipsum massa aliquet nulla, non elementum mi elit a mauris. ... Лаборатория катализа и газовой электрохимии | ...

Еще в разделе: (Показать все результаты (>10) - tragaty.chem.msu.ru/ )

The Astronomical Journal welcomes new submissions at IOP Publishing . ... From: Andrew Wray < andrew.wray@iop.org > . ... On behalf of the IOP-AAS Project Team, I am delighted to announce that IOP Publishing is now processing all new submissions to the AJ. Submitting a new article . To submit a new article to the journal, go to http://authors.iop.org/aj , where you will find our beta version of the new AJ web submission site. ... Refereeing an article . ... IOP Publishing . ...

Еще в разделе: (Показать все результаты (>54) - sai.msu.ru/ )

• GCVS Research Group: Homepage.

. 8.1. ARS study in Crimea at the place Patil. 8.2. ARS study near Moscow (with low anisotropy of morain sediments) - at the place Alexandrovka . 119899, Russia, Moscow, Moscow State University, Geological Faculty, Department of Geophysics . V.A. Shevnin, I.N. Modin . Tel. & fax: (7-095) 939 49 63 . E-mail: sh@geophys.geol.msu.ru . Please feel free to send us your comments.

Еще в разделе: (Показать все результаты (>87) - geophys.geol.msu.ru/ )

• TRF_2d. Page 3.
• КАФЕДРА ГЕОФИЗИЧЕСКИХ МЕТОДОВ ИССЛЕДОВАНИЙ ЗЕМНОЙ КОРЫ
• TES. Median algorithm

. Moscow Astronomical Plate Archives: Contents, Digitization, Current and Possible Applications. Light Curves of New Variable Stars Discovered on Scans of Moscow Collection Plates, Field 66 Oph (MDV). MDV catalog - CDS access. Moscow plate collection (Sternberg Astronomical Institute), S.Yu. Shugarov's interactive page. Send questions and comments to N. Samus and S. Antipin .

Еще в разделе: (Показать все результаты (>15) - www.sai.msu.ru/ )