... Carbon and Nitrogen As Resources Limiting the Growth of Mono- and Mixed Cultures of Pseudomonas aeruginosa Dissociants P. V. Fursovaa, E. S. Mil'kob, and A. P. Levichc c Department of Biophysics Department of Microbiology Department of General Ecology, Moscow State University, Moscow, 119991 Russia e-mail: fursova @biophys.msu.ru b a Received December 26, 2006 Abstract--New experiments for detection of resources limiting the ... 1997; Levich, 2000). ... 1) (Levich et al., ...

Еще в разделе: (Показать все результаты (>13) - dis.bio.msu.ru/ )

• http://dis.bio.msu.ru/States/Milko_Kreier_2007_en.pdf

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>3) - sinp.msu.ru/ )

... Projects . ... 32-bit Microcontroller Programming . ... The project is working on creating a robot-platform which performs hopping movement, an absolutely new principle of movement for automatons. ... A robot requires a wide range of sensors and complex algorithms of position stabilization in order to keep calculations on stable position of the legs when walking on uneven surface. ... His field is the system of hop initiation while Serguey Lonchakov is working on the stabilization of the position. ...

Еще в разделе: (Показать все результаты (>8) - engineering.phys.msu.ru/ )

... Living systems depository "Noah's Ark" . ... About the project . ... The project of the Moscow State University "Noah's Ark" is dedicated to the creation of multi-functional network storage of biological material. ... Creation of temporary prototypes of living systems depository bank for storage and research of the collected material. ... Development of algorithms for the information processes analysis in living systems for receiving, filing and processing of various types of biological data. ...

Еще в разделе: (Показать все результаты (>3) - depository.msu.ru/ )

• Plants | depozitariy

... Students . Phd students . Practical work . For 2 grad students . ... Grad. students . ... Work time: . Monday 10:00-15:00 . Saturday 10:00-15:00 . Signing up for practical work is possible only during work time of the practicum . ... Описание задачи . Mechanical resonance. Movement of magnetized rod in non-uniform magnetic field. ... Magnetic resonance. ... SHF Faraday effect in ferrites. ... Kerr effect. ... Hall effect. ...

Еще в разделе: (Показать все результаты (>17) - magn.phys.msu.ru/ )

... term paleosol is a complete non sense. ... 20 years with paeosols wthotuh needing the word, and even more trying to . ... paeosols in noder not to be caught in the actualistic concept of soil . ... idea to put these two words together when soil is obviously part of the . ... As Fitz seems to be, I think I am doing well with buried soils when well . identified, pedo units when only a part is preserved and pedosediments for . ... Marie-Agnes COURTY . ... 0130815427 . Fax: 0130815396 . ...

Еще в разделе: (Показать все результаты (>99) - www.fadr.msu.ru/ )

• http://www.paleopedology.msu.ru/discussions/messages/198.html
• Abstracts
• IMPLICATIONS OF POSSIBLE CHANGES

... Персональная информация о Yamapikarya . ... 06.10.2005 15:49 . ...

Еще в разделе: (Показать все результаты (>1083) - www.fds-net.ru/ )

• Программисты шутят - Public forum of MSU united student networks
• American english club - Public forum of MSU united student networks
• [Linux] Disabled in configuration - Public forum of MSU united student networks

... What does people think about in my country? ... Some Situations are roots in communism, other are new situations created after 1990. ... In this very moment we have many private schools initiated and supported by many different ONG's. Changing the character of education . ... In Romania we need a different education system, one that is supported by society. ... The ramifications of educations system, based on the needs and the development of the economy as well as social and cultural life, go on. ...

Еще в разделе: (Показать все результаты (>51) - www.prof.msu.ru/ )

• About the importance of founding teleecommunication centres in developing areas
• The American Theatre and Drama Society (Call for papers)
• INTERNET AND DEMOCRACY

... 12, 43 ­ 44 (2012) / DOI 10.1002/pamm.201210013 Cases of Complete Integrability in Transcendental Functions in Dynamics and Certain Invariant Indices Maxim V. Shamolin1, 1 Institute of Mechanics, Lomonosov Moscow State University, Michurinskii Ave., 1, 119899 Moscow, Russian Federation The results of this work appeared in the process of studying a certain problem on the rigid body motion in a medium with resistance, where we needed to deal with first integrals having nonstandard properties. ...

Еще в разделе: (Показать все результаты (>42) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-185-2.pdf
• http://shamolin2.imec.msu.ru/art-168-1.pdf
• http://shamolin2.imec.msu.ru/art-104-1.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

... Description . Catalog . ... In the Catalog, we publish equatorial (ЮБ 2000 , ЮД 2000 ) and galactic (l,b) coordinates of cluster centers derived as the position of overdensity in 2MASS catalog (Koposov et al. ... Distances, color-excesses and ages are the mean-square values calculated using all available evaluations from different color-magnitude diagrams. ... There are individual pages for every cluster where all available plots and parameters are published. ... 2002). ...

Еще в разделе: (Показать все результаты (>2) - ocl.sai.msu.ru/ )

Модельное изучение качества воздуха при сравнении двух возможных мест расположения нового международного аэропорта в Мехико. An air quality modeling study comparing two possible sites for the new international airport for Mexico City / Jazcilevich Aron D., Garcia Agustin R., Ruiz-Suarez L. Gerardo, Cruz-Nunez Xochitl, Delgado Javier C., Tellez Carlos, Chias Luis B. // J. Air and Waste Manag. ... Модель качества воздуха включает метеорол. модель ММ5 и современный уровень развития фотохимии. ...

Еще в разделе: (Показать все результаты (>10) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=28&from=0&ref_ind=0210000225
• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=15&from=0&ref_ind=0207100085

... Математический семинар Глобус, заседание 17 мая 2007 г. В четверг, 17 мая 2007 года, в 15:40 в конференц-зале НМУ, Б. Власьевский 11, состоится доклад: Супержесткость и обобщенные группы вейля. ... The celebrated superrigidity theorems of Margulis and Zimmer inspired a lot of research on possible generalizations and analogues of the superrigidity phenomena beyond the framework of Lie groups. ... Based on a joint work with Uri Bader, and with Bader and Shaker. ...

Еще в разделе: (Показать все результаты (>87) - www.mmonline.ru/ )

• MMOnline | Форумы | Разное | Требуется Web - дизайнер.
• MMOnline | Форумы | Аспирантура | Позиция постдока в Университете Бергена,

... High Brightness RTM . ... Fig.1a: 70-MeV pulsed race-track microtron . Many applications require compact, inexpensive and efficient source of electron beam in energy range 10-100 MeV. ... Beam is focused by accelerating structure, which acts as RF quadrupole singlet, quadrupole triplets (12) installed at the even orbits return path and by electromagnet quadrupole singlet (9) installed at common axis. ... Fig.1b: 70-MeV RTM Schematic . ... Energy gain: 4.8 MeV / orbit . Orbits: 14 . ...

Еще в разделе: (Показать все результаты (>3) - vserv.sinp.msu.ru/ )

Model Answer This model answer has been written by an examiner as an example of a very good answer. However, please note that this is just one approach out of many possible ways. ... The author considers two solutions for/to the task: empirical (experimental) and geometric (hypothetical, theoretical). The article goes on to say that there is, actually, a simple way of ultimate connection. ... The height values of the two tilings differ in one flip in the centre of the hexagon. ...

Еще в разделе: (Показать все результаты (>16) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/section4.pdf
• http://www.eng.math.msu.su/download/dictionary.pdf

30 TH I NT E R N AT I ON AL C OSMIC R AY C O N F ER EN C E Search for global asymmetry of UHECR arrival directions with the TUS space detector P. K LI M OV 1 ,O. K AL ASHE V 2 , B . ... Introduction Space-based ultra-high-energy cosmic-ray detectors such as TUS or JEM/EUSO are best suited for searches of the global anisotropies in the distribution of arrival directions of cosmic-ray particles because they provide full-sky coverage with a single experiment. ... Phys. 12, 25 (1999). ... Phys. Lett. ...

Еще в разделе: (Показать все результаты (>3) - cosrad.sinp.msu.ru/ )

• http://cosrad.sinp.msu.ru/experiments/tus/doc/HO2COSPAR2006.pdf

... Выпускники . Выпускники ВМиК . Канада (+США) . Новости США и Канады . ... Женский клуб . ... Издательство МГУ . ... Новости для выпускников . МГУ им.Ломоносова . ... База данных выпускников . ... Выпускники МГУ . ... Дайв-Клуб МГУ . ... Для средней руки программиста самое главное для нахождения первой работы - это references (то есть письменные и устные рекомендации с предыдущих мест работы). ... Оставь свой комментарий первым . ...

Еще в разделе: (Показать все результаты (>150) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Правительство открыло сайт, где можно записаться в
• Клуб выпускников МГУ: CRISIS IN THEORETICAL PHYSICS: THE PROBLEM OF SCIENTIFIC
• Клуб выпускников МГУ: КИБЕРНЕТИЧЕСКАЯ ЛИЧНОСТЬ. БЕССМЕРТИЕ?

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>7) - iconolat13.phys.msu.ru/ )

• Symposia

... MATHEMATICS Evaluation of Multiple Eigenvalues and Jordan Chains of Vectors for Matrices Depending on Parameters A. A. Mailybaev Presented by Academician N.S. Bakhvalov April 5, 2001 Received April 6, 2001 The reduction of a matrix to the Jordan form is an unstable operation if the matrix has multiple eigenvalues. ... Let p' d be a point in this manifold. ... The multiple eigenvalues and the corresponding Jordan chains at the points of stratum are defined by relations (6), (7) for every i' . ...

Еще в разделе: (Показать все результаты (>31) - mailybaev.imec.msu.ru/ )

• http://mailybaev.imec.msu.ru/reviews/Chillingworth.pdf
• http://mailybaev.imec.msu.ru/papers/Mailybaev2005.pdf
• http://mailybaev.imec.msu.ru/papers/mailybaevseyranian2008.pdf

... The mo del is a directed dyadic acyclic graph. ... New vertexes are added one by one. The probability of this addition dep ends on the structure of existed graph. ... 4 (2 ) FIGURE 4: The probabilities of different variants to add a new vertex to the future in the step number 500. pij is the probability to add a new vertex to the outgoing external edges numbers i and j . Similarly, p is the probability to add a new vertex to the incoming external edges numbers and . ...

Еще в разделе: (Показать все результаты (>19) - temporology.bio.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/korotaev_experimental.pdf
• http://temporology.bio.msu.ru/EREPORTS/krugly_amplitudes.pdf
• http://temporology.bio.msu.ru/EREPORTS/krugly_discreet-mechanics.pdf