... Destructive effects of many tsunamis are confined to areas within about one hour of the initial propagation time (that is, within a few hundred km of their source). ... Two international tsunami workshops have recently been held in Russia ( "Tsunami Mitigation and Risk Assessment," Petropavlovsk-Kamchatskiy,1996 , and "Tsunami Risk Assessment Beyond 2000: Theory, Practice and Plans," Moscow, 2000). ... The final product of the workshop will be recommendations on local tsunami warning and mitigation....

Еще в разделе: (Показать все результаты (>27) - seac47-2.phys.msu.ru/ )

• LOCAL TSUNAMI WARNING AND MITIGATION

Invisible Higgs in weak bosons associative production with heavy quarks at LHC Sergei Demidov Institute for Nuclear Research RAS in collaboration with E. Boos (SINP MSU) and D. Gorbunov (INR RAS) 9 September, 2010 E. Boos, D. Gorbunov, S. Demidov (INR RAS) Invisible Higgs 9 September, 2010 1 / 15 Introduction Standard Model. ... 2003) Why does missing pT come from Higgs boson? ... V via q q VV scattering where q is Higgs mass range mH < 2MV , vir tual Higgs, probing the Higgs width H . ...

Еще в разделе: (Показать все результаты (>144) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2015/Chesnokov_QFTHEP%202015.pdf
• September 13, 2010
• Support for young Russian scientists / Поддержка молодых российских ученых

Magnetism Department MSU . ... Research groups . ... Students . Phd students . ... The basics of spintronics. prof . Vedyaev ю. Actual problems in modern magnetism . prof . Granovsky A. The physical basics of magnetism . associate prof . Kotel'nikova O. Magnetic phase transitions. associate prof . Kotel'nikova O. Physics of magnetic phenomena. associate prof . Kotel'nikova O. Introduction in group theory and its application in physics of magnetic phenomena. associate ...

Еще в разделе: (Показать все результаты (>27) - magn.phys.msu.ru/ )

• Information about education on magnetism division
• Полезные ссылки

FemtoScan 001 - FAQ . Russian version . ... How to build a histogram for a part of image . ... How to copy and print files seen in Quick View . Quick View Parameters and other options . About Macros . ... Choose the command Parameters in the menu View or in the popup menu, which appears after pressing the right button of the Mouse. ... All the images seen in Quick View . ... QuickView] - Legend view, seen on the images of Quick View , number of images ( Show All Images ) . ...

Еще в разделе: (Показать все результаты (>62) - www.spm.genebee.msu.ru/ )

• Igor Yaminsky's homepage
• Bagrov Dmitry

... Medium (solvent) coordinates 3. Quantum effect of solvent on activation barrier 4. ... sucrose solutions: C D ( w) = + + 1 + (iw C ) 1 + iw water-EG mixtures: D 3 1 2 ( ) = + + + 1 + i 2 1 1 + i 2 2 1 + i 2 3 series N solvent modes Solvent reorganization energy (exact expansion ) correlation times K ( ) = 2k BT Solvent correlation function i =1 N i exp (- / ) * i i =1 N i = 1 i is the contribution of i-th mode to the solvent reorganization energy The solvent reorganization ...

Еще в разделе: (Показать все результаты (>21) - www.elch.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/mole/lecture/qantipov.pdf
• Laboratory of Electrical Double Layer and Electrode Kinetics
• Molecular aspects of solid state and interfacial electrochemistry

Title Should Be in Bold, 18-Point Type and Centered, Please Use Title Case Author name(s) [10-point type, centered, bolded] Author affiliation and full address (8-point type, centered, italicized) Author e-mail address: (8-point type, centered, italicized) Abstract: Indent left and right margins 0.5 in. (1.27 cm), justify the paragraph (on both right and left), and use the same font as in the body of the paper. ... 5] Author(s), "Title of paper," in Title of Proceedings, Name(s), ed(s)., ...

Еще в разделе: (Показать все результаты (>12) - iconolat13.phys.msu.ru/ )

• Invited speakers
• Program topics

ВМиК-Online! ... Студенты . ... Выпускники . Работа . ... Компания HP создает новые возможности для того, чтобы технологии приносили максимальную пользу людям, компаниям, государственным структурам и обществу в целом. ... Бизнес HP в России уже 6 лет подряд показывает результаты лучше рынка ИТ в целом. ... Вакансии компании Hewlett-Packard: . ... Телефон компании HP: +7 (495) 797-35-00. ... МГУ . ... Рейтинг компаний составляется на основе данных Клуба выпускников МГУ . ... 2001 2012 ВМиК Online! ...

Еще в разделе: (Показать все результаты (>12) - www.cmc-online.ru/ )

• ВМиК - Online! : Абитуриентам факультета ВМК МГУ - Варианты по английскому...

... Science Festival will take place in Moscow on October 10-12 2014. Engineering Physics Laboratory will participate in the IX Science Fectival. During the Science Festival many events will take place: lectures by Nobel Laureates, lectures by eminent scientists and popularizers of science, meeting with astronaut, demonstration of the latest scientific developments and inventions. Engineering Physics Laboratory will show main projects and tell you about achievements. ...

Еще в разделе: (Показать все результаты (>91) - engineering.phys.msu.ru/ )

• Parallel Programming
• Science Festival 2015
• Jumping Robot

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>3) - edas2.bioinf.fbb.msu.ru/ )

• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

In the three and a half years of itтАЩs existence, the participants of the Ecological Cooperation Project have carried out more than 200 activities towards conserving and protecting the environment. ... Activities: . ... During the "We'll Conserve the EarthтАЩs Beauty" project at the Silicate lakes, near Lipetsk, the waste around a lake and in a forested area nearby was cleaned up. ... The members of ecological club from Gymnasium #1529, in Moscow, had a summer expedition to Solovetsky museum in 1999. ...

Еще в разделе: (Показать все результаты (>73) - www.ecocoop.ru/ )

DOI: 10.7256/2222-1972.2014.5.14682 doi « »: ( ) : . ... 526 © NOTA BENE ( «-») « » XI ., ... 527 © NOTA BENE ( «-») : 5 (23) · 2014 DOI: 10.7256/2222-1972.2014.5.14682 . ... XVI­XVIII . ... NOTA BENE ( «-») DOI: 10.7256/2222-1972.2014.5.14682 , [1, 7]. ... 529 © NOTA BENE ( «-») : 5 (23) · 2014 DOI: 10.7256/2222-1972.2014.5.14682 ­ , : « , " "». ... NOTA BENE ( «-») DOI: 10.7256/2222-1972.2014.5.14682 , « » [14, 155]. ... NOTA BENE ( «-») 533 : 5 (23) · 2014 DOI: 10.7256/2222-1972.2014.5.14682 27. ...

Еще в разделе: (Показать все результаты (>13) - www.hist.msu.ru/ )

Q: Recently I read a book called ?C14-CrashЃ by Christian Bloess and Hans-Ulrich Niemitz (there is a summary in German with figures on . ... Briefly, the authors claim that the majority of the original assumptions made by Libby for the radiocarbon . ... directly calculated from a C14 value." ... such fractions are used for calibrations and dating. ... used for radiocarbon calibration. ... important after atmosphere reservoir - upper ocean. ... radiocarbon content in the atmosphere. ...

Еще в разделе: (Показать все результаты (>96) - hbar.phys.msu.ru/ )

• Age Determinations by Radiocarbon Content: Checks with Samples of Known Age

... CUDA Center of Excellence | MSU . ... Lomonosov Moscow State University (MSU) was awarded an NVIDIA CUDA Center of Excellence (CCOE) in 2011 for being one of the first Russian universities to recognize the importance of emerging GPU technologies and first to embrace CUDA. ... Lomonosov Moscow State University (MSU) is renowned as one of the leading computer science centers excelling in application of computational resources to address most vital scientific problems. ...

Еще в разделе: (Показать все результаты (>3) - ccoe.msu.ru/ )

CURRICULUM VITAE Last name: Straupe Name: Stanislav Middle name: Sergeevich Date and place of birth: 12 January 1984, Moscow , Russia Business address: International Laser Center, M.V.Lomonosov Moscow State University , Moscow 119899, Russia, Fax: 7(495)9391104; Phone: 7(495)939-43-72 Home address: Sivcev Vragek, 15/25, ap.39, ... S. P. Kulik, G. A. Maslennikov, E.V. Moreva, S.S. Straupe, "Quantum tomography of the optical four level states", Proceedings of SPIE, 6181, 618101 (2006) 2 ...

Еще в разделе: (Показать все результаты (>64) - qi.phys.msu.ru/ )

• Publications :: Quantum Information Laboratory
• Sergei Kulik: Scientific interest

... Education: Moscow Institute of Physics-and Techniques (MFTI), 1955 – 1961 . ... Engineer – Physic, MFTI Diploma, 1961 . candidate of physics and mathematics, 1967 . ... Scientific Award: 1992 , Linneaus Medal in Silver, Royal Academy of Sciences of Sweden. ... 1961 – 1967 Engineer, Scientific Researcher . ... Present position: Leading Scientist, Department of Space Physics, Scobeltsyn Institute of Nuclear Physics, Moscow State University . ... ph: +7 095 939 42 90 (office) . ...

Еще в разделе: (Показать все результаты (>117) - www.kosmofizika.ru/ )

• Science Technology: Ongoing Solar Activity

VI Moscow International Conference on Operation Research (ORM2010) Moscow, October 19-23, 2010 Dear colleague! Dorodnicyn Computing Center of RAS (CC of RAS), Lomonosov Moscow State University and Russian Scientific Operation Research Society will organize the VIth Moscow International Conference on Operation Reserach in 19-23 of October 2010. ... Topics of the conference include: Coordinators: |Contemporary problems of operation |V.V. Morozov | research. ... I.G. Pospelov, A.A. Shananin | ...

Еще в разделе: (Показать все результаты (>21) - io.cmc.msu.ru/ )

• http://io.cs.msu.ru/ORM2007/template_eng.doc
• http://io.cs.msu.ru/ORM2013/Program_ORM2013_RUS.pdf
• Кафедра Исследования Операций

... mechanic . ... engineer . ... senior researcher . ... 77 (floor -1) . ... Fedoseev Anatoly Ivanovich . docent . ... spekl@phys.msu.ru . ... Hlystov Vladimir Ivanovich . ... Ivanov Sergey Nikolaevich . leading engineer . 939-31-69 . sni@opts.phys.msu.ru . ... iak@opts.phys.msu.ru . ... Kolobanov Vitaly Nikolaevich . ... 2-07 (SINP MSU) . ... korolenko@optics.npi.msu.su . ... junior researcher . ... researcher . ... researcher (SINP MSU) . ... 71 (floor -1), 4-13(SINP MSU) . ...

Еще в разделе: (Показать все результаты (>2) - opts.phys.msu.ru/ )

• http://opts.phys.msu.ru/rus/fiber-laboratory.html

... This is so elementary it hardly needs comment . ... Единица (меньше единицы по модулю) . ... Group unit element . ... Единичная геометрическая краткость . ... Unit normal . ... Let $v$ be a vector of unit length . Единичный вектор внешней нормали . Unit outer normal vector . Outer normal unit vector . Единичный вектор восходящей нормали . ... Единичный вектор касательной . ... Единичный вектор направления движения . ... Normal unit vector . Unit normal vector . ... One component . ...

Еще в разделе: (Показать все результаты (>80) - num-anal.srcc.msu.ru/ )

• http://num-anal.srcc.msu.su/list_wrk/ps1/ch3st4.ps
• БЧА НИВЦ МГУ. ALD1R_C. Специальные задачи линейной алгебры
• БЧА НИВЦ МГУ. ALN1R_C. Специальные задачи линейной алгебры

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

SEMINAR Singular Perturbations and Time Scales (SPaTS) in Control Theory and Applications 14:30 PM, Saturday, June 23, 2012, Room 5-18 Faculty of Physics, M.V. Lomonosov Moscow State University , Moscow, Russia Professor D. Subbaram Naidu , PhD, PE, Fellow IEEE Director and Professor, School of Engineering Director, Measurement and Control Engineering Research Center Idaho State ...

Еще в разделе: (Показать все результаты (>18) - matematika.phys.msu.ru/ )

• Кафедра математики Физического Факультета МГУ им. М.В. Ломоносова | Наши
• Кафедра математики Физического Факультета МГУ им. М.В. Ломоносова | Научная