Photo-induced delayed luminescence ( DL ) following a visible light excitation in air-dry seeds of various plants has been observed. ... The shape of DL distribution curve depends on homogeneity of seed population. ... Veselova, T.V., Veselovskii, V.A., Rubin, A.B., Bochvarov, P.Z. Delayed luminescence of air-dry soybean seeds as a measure of their viability. ... Veselova, T.V., Veselovsky, V.A., Kozar, V.I., Rubin, A.B. Delayed luminescence of soybean seeds during swelling and accelerated aging. ...
... Keywords: mass media, media industry, media psychology, media audience, homo mediatis Having become an essential part of the modern economy in the postindustrial world, the media have inevitably also become one of the most profitable and powerful industries.Their political, social, and cultural nature is directly influenced by entrepreneurial activity and the market laws of supply and demand (Albarran, 2010). ... Modern people "check" a considerable portion of their political decisions with the...
. Please standby and you will be automatically connected to the new location of the unframed Supernova page. Or, click on the link above. If you have questions or problems, please email me at David Bishop dbishop@vhdl.org . Last modified: Mon Aug 27 12:40:15 EDT 2001
... About 70 scientific papers. The theory of square parachute is created, describing distribution of parameters of shape, tension and resistance to airflow of canopy in steady-state condition for various sets of suspension line lengths and air-permeability. ... The practical recommendations for optimal parachute application are submitted. ... It is discovered experimentally that a character of pressure distribution for a square canopy depends on a particular choice of suspension line lengths. ...
... Летние школы . ... Школы юных и кружки при факультетах МГУ . ... МГУ организует выездные лекции в школы Москвы с целью профессиональной ориентации и для знакомства школьников с наукой и высокими технологиями . Детский лагерь - Научно-образовательная школа Лаборатории научного творчества СУНЦ МГУ начинает набор желающих на смены 2015 года. ... школе (съезды учителей, летние школы учителей, курсы повышения квалификации для учителей). ... Вы можете задать вопрос о программе "МГУ - ШКОЛЕ" . ...
... X-Com key features (2) · Lightweight portable toolkit: easy to install · Perl-based software · doesn't need administrator/root access ... must be written simultaneous work of different platforms · joining Windows and Linux machines distributed freely · BSD license X-Com basic requirements · Linux / Windows · Perl 5.8.0+ for Windows: · Strawberry Perl (preferred) · ActivePerl · Open TCP port for Task initializing on server side Server part of the application 2. ... Portion request 6. ...
[
Текст
]
Ссылки http://hpc.msu.ru/files/hpcmsu/downloads/X-Com_tutorial.pdf -- 667.6 Кб -- 15.06.2012 Похожие документы
... With the usage of on-land and satellite altimetrical measurements data some gravity map were made, averaged on one degree trapeziums, in reductions Faja, Bouguer, Glenni, which were included in the geological-geophysical international atlases of Atlantic, Indian and Pacific oceans. ... Boldirev S.A., Gajnanov A.G., Stroev P.A. Dencital inhomogeneities in lithosphere and dynamics of development of the North-West part of the Pacific mobile belt. ... Moscow, Nedra edition, 1967. ...
FCNC Penguin Processes in Models Beyond the SM . ... The Standard Model (The SM) Simple extensions of the SM Supersymmetric models Extra dimensional models Strongly coupled and effecBve field theories The Standard Model : Standard Model of ParBcle Physics Simple extensions of the SM: Several models based on the SM that include one or more addiBonal parBcles, like a 4th generaBon, a second Higgs doublet or addiBonal colored scalars Supersymmetric Models : Various supersymmetric ...
Department of Physics, Lomonosov Moscow State University . ... We need both good experimentalists and theorists, that want to work, to acheive this difficult goal. ... Molecular transistor based on a Scanning Tunnel Microscope tip (Laboratory of Cryoelectronics 1996) . ... Division of Atomic Physics, Plasma Physics, and Microelectronics . E: This email address is being protected from spambots. You need JavaScript enabled to view it. ... Faculty of Physics . ...
... Лекции . ... Бакинский филиал МГУ . ... Это сайт для тех, кто изучает или преподает Физическую Химию: химическую термодинамику и химическую кинетику. На сайте помещены лекции по Физической химии для студентов Химического факультета МГУ (Общий курс), лекционные презентации и материалы для подготовки к экзаменам. ... 09.04.16 Новый вариант лекции 15 весеннего семестра. ... 09.02.16 Исправленный вариант лекции 13 осеннего семестра . ... Химфак МГУ . ... 2014-2016 ћ Лекции по физической химии . ...
General Information . ... The conference is organized by the Sternberg Astronomical Institute (SAI) of Moscow University and the IAU Working group "Site-testing Instruments" . ... Use of site data in telescope operation and adaptive optics. ... Recent conferences on this subject (2007, 2008) demonstrated great interest of the community, hence the need for a new meeting. ... Unlike previous recent conferences, this meeting will cover all aspects of site monitoring for optical/IR astronomy. ...
... News . ... Create new account (active tab) . ... Request new password . ... E-mail address * . A valid e-mail address. All e-mails from the system will be sent to this address. The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. Group - None - 217 (2016 пЕпѕпґ) 219 (2016 пЕпѕпґ) 217 (2015 пЕпѕпґ) 215 (2015 пЕпѕпґ) 217 (2014 пЕпѕпґ) 215 (2014 пЕпѕпґ) 315 316 219 218 117 CAPTCHA . ...
The Nine Planets is best viewed on-line via a graphical WWW browser which displays the pictures in color and supports hypertext link traversal. ... To view the movies and hear the sounds, you'll need additional helper programs. ... I recommend that you use Netscape as your browser. Netscape can display gif and jpeg images directly without need of any additional helper apps. You do need additional helper apps for movies and sounds, however. ... Yahoo's Helper Applications .. ... Tech Help .. ...
... The Adhesive Mechanism of Hysteretic Nonlinearity for Media with Cracks . ... The creation of models of different defects (dislocations, cracks etc.) and construction of state equations for solids containing such defects, is one of modern problems of nonlinear acoustics and seismic-acoustics. ... This circumstance creates favorable capabilities for nonlinear acoustic diagnostics of both single defects in solids, and solids containing a great number of such defects. ...
Magnetism Department MSU . ... Magnetism department . ... Magnetic Laboratory was created in Moscow State University by professor Vladimir Arkad ev. ... In 1918 Arkad ev returned in MSU where he founded Moscow Magnetic Laboratory, which exists for a long time on the enthusiasm of their members. ... As the head of new department professor Nikolay Akulov was assigned. ... During the period since 1954 till 1987 the head of magnetism division was Eugeny Kondorsky. ... Lomonosov MSU . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы