... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...

Еще в разделе: (Показать все результаты (>3) - sa.cs.msu.ru/ )

... All rights reserved 0301-5629/98/$­see front matter PII S0301-5629(98)00110-0 Original Contribution SHEAR WAVE ELASTICITY IMAGING : A NEW ULTRASONIC TECHNOLOGY OF MEDICAL DIAGNOSTICS A RMEN P. SARVAZYAN,* OLEG V. RUDENKO, SCOTT D. SWANSON, J. BRIAN F and STANISLAV ... Engineering Department, University of Michigan, Ann Arbor, MI (Received 5 September 1997; in final form 2 July 1998) Abstract-- Shear wave elasticity imaging ( ... Schematic presentation of shear wave elasticity imaging....

Еще в разделе: (Показать все результаты (>49) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/gordienko_files/localization_eng.pdf
• http://acoustics.phys.msu.su/teachers/gusev_files/nano2.pdf
• http://acoustics.phys.msu.su/conf2006.htm

... Molecular Mechanics Calculations of beta-Diketonate, Aqua, And Aqua-beta-Diketonate Complexes of Lanthanide Ions Using Gillespie-Kepert Model . ... Abstract - A version of molecular mechanics based on the Gillespie-Kepert model of coordination bonds "repulsion" is applied to lanthanide complexes. ... For the aqua complexes, typical root-mean-square deviation (calculated vs. ...

Еще в разделе: (Показать все результаты (>32) - analyt.chem.msu.ru/ )

• Molecular mechanics study of the mixed-ligand lanthanide complexes using
• Study of amino- and pyridyl-containing zinc(II) and cadmium(II) complexes by

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... November 5, 1997 . The Milky Way's Gamma-Ray Halo . Credit: D. Dixon ( UCR ), D. Hartmann ( Clemson ), E. Kolaczyk ( U. Chicago ), NASA . Explanation: Our Milky Way galaxy appears to be surrounded by a halo of gamma rays . Gamma rays are the most energetic form of electromagnetic radiation , with more than a hundred thousand times the energy of visible light, but known gamma-ray sources don't account for the diffuse distribution of this high-energy glow. ... About APOD > . ...

Еще в разделе: (Показать все результаты (>24) - www.arcetri.astro.it/ )

• APOD: July 10, 1998 - Interacting Galaxies

... В качестве сравнительного материала определялся уровень стероидных гормонов в московской выборке (480 человек). ... Проведены две серии экспериментов для определения высотного соотношения между опорными поверхностями элементов рабочего места. ... Серии отличались высотой сиденья. ... Международный симпозиум, посвященный 150-летию парижского антропологического общества, 'От концепций из прошлого к исследованиям в будущем', 26-30 января 2009, Париж (А.П. Бужилова) (стр. ...

Еще в разделе: (Показать все результаты (>22) - www.anthropos.msu.ru/ )

... Время и взаимодействие . ... Гравитация как следствие расширения среды весомых тел [размещено на сайте 15.05.2009] . ... С.176-206 (PDF-файл, 1.2 Мб) [обновлено на сайте 15.04.2009] . ... PDF-файл, 7577 Кб) [размещено на сайте 03.11.2013] . ... Время и квантовое поведение (PDF-файл, 630 Кб) [размещено на сайте 09.06.2006] . ... Interacting Two-Time Physics Field Theory With a BRST Gauge Invariant Action (PDF file, 300 Kb) [distributed 01.07.2007] . ... PDF-file, 233 Kb), [Distributed 08.11.2010]. ...

Еще в разделе: (Показать все результаты (>20) - temporology.bio.msu.ru/ )

• Institute Laboratory-Chairs
• Уравнения динамики систем

A project of laser electron X-ray generator for scientific applications I.A. Artyukov, E.G. Bessonov, A.V. Vinogradov, M.V. Gorbunkov, Yu.Ya. ... The possibility of the creation and the application prospects of the laser-electron X-ray generator based on Thompson scattering of laser radiation on a bunch of relativistic electrons are considered. ... It allows viewing collision of electrons with laser photons as the classical Thomson scattering. ... A project of X-ray laser-electron generator [7]. ...

Еще в разделе: (Показать все результаты (>9) - miles.sinp.msu.ru/ )

• http://miles.sinp.msu.ru/files/Instr&Exp_Tech_Engl.pdf
• http://miles.sinp.msu.ru/files/LEXG_ICLIM_2004.pdf

... Prof, head of the laboratory of x-ray diffraction and crystal chemistry Home address: Russia, 115470, Prosp. ... 1964-1969 a student of Geological faculty MSU, department of crystallography 1969-1973 a post graduate student (scientific advisor academician N.V.Belov) 1974 Ph.D., speciality 'Crystallography and Crystalphysica', title of Ph.D. Thesis 'Crystal structures of (Na,Cd)-germanates' 1994 D.Sc., speciality 'Physical chemistry', title of D.Sc. ... E.L.Belokoneva, L.I.Leonjuk, V.S.Urusov. ...

Еще в разделе: (Показать все результаты (>36) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/history/70let.pdf
• http://cryst.geol.msu.ru/literature/lit_dudnik.php
• http://cryst.geol.msu.ru/literature/lit_urusov.php

EFFECT OF pH AND VFA ON H YDROLYSIS OF ORGANIC SOLID W ASTE By Adrie Veeken,1 Sergey Kalyuzhnyi,2 Heijo Scharff,3 and Bert Hamelers4 ABSTRACT: The anaerobic hydrolysis rate of organic solid waste was studied at fixed volatile fatty acid (VFA) concentrations ranging from 3 to 30 g COD/ L and fixed pH values between 5 and 7. ... In this way, it was possible to distinguish between the inhibitory effects of pH, total VFA, and undissociated VFA on anaerobic hydrolysis. ... VFA control. ...

Еще в разделе: (Показать все результаты (>134) - www.enzyme.chem.msu.ru/ )

• http://www.enzyme.chem.msu.ru/ekbio/article/UASB2006.pdf
• http://www.enzyme.chem.msu.ru/ekbio/article/biod98-9.pdf
• http://www.enzyme.chem.msu.ru/ekbio/article/dpfl_model.pdf

... Scientific goals . ... Automatic gaze stabilization corrector . Scientific equipment . ... IMISS-1 . ... Comparing the measured and calculated values we?ll find out if it is possible to use microelectromechanical inertial measuring modules in an automatic gaze stabilization corrector , and calculate the value of changes of microsensors? instrumental errors under the space conditions as against the Earth ones. ...

Еще в разделе: (Показать все результаты (>61) - lomonosov.sinp.msu.ru/ )

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>2) - tex.bog.msu.ru/ )

... Выпускники . ... Женский клуб . ... Издательство МГУ . ... The correct theoretical analysis of the generally accepted foundations of theoretical physics is proposed. ... The main result is as follows: the foundations (i.e. classical thermodynamics, the special theory of relativity, quantum mechanics) contain logical errors The existence of logical errors is irrefutable proof of incorrectness of the theoretical foundations and means that theoretical physics enters the greatest crisis. ...

Еще в разделе: (Показать все результаты (>339) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Конференция "Выпускники МГУ в Канаде"
• Клуб выпускников МГУ: В крови нашли 22 биомаркера старения
• Клуб выпускников МГУ: IN VITRO ВЛИЯНИЕ ОПЕРАТОРА ЦИГУН НА ИЗМЕНЕНИЕ

179. Intelligent Systems :: Research :: :: Research

180. MMOnline | Новости | Математический семинар Глобус. 11 марта 2004 г.