Title Author Key words Theory, approaches and dynamics of social systems Agapov P.V. methodological approaches, the social system, social dynamics, social evolution, social synergy and cybernetics, social structure and transformation of hermeneutics The article deals with the dynamics of methodological approaches in the study of social systems. ... Abstract ...

Еще в разделе: (Показать все результаты (>31) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/eng/archive/2015/3/11.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2014/3/08.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2014/4/15.pdf

... We develop a theory of vertical hopping transport in doped superlattices with intentional uncorrelated vertical disorder introduced by controlled random variations of well widths. ... It is shown that due to quasi-equilibrium situation within the wells, the master rate equation for transitions between the electronic states of the structure can be reduced to a truncated rate equation for inter-well transitions only. ...

Еще в разделе: (Показать все результаты (>45) - scon155.phys.msu.su/ )

• Kinetics of domain structure in ferroelectric thin films
• First-principles calculations of physical properties of crystals
• Program of the 5th Russian-Japanese Symposium on Ferroelectricity (Moscow,

Psychology in Russia: State of the Art Volume 6, Issue 3, 2013 Russian Psychological Society Lomonosov Moscow State University automated real-time classification of functional states: significance of individual tuning stage Vladimir V. Galatenko, Evgeniy D. Livshitz, Alexander M. Chernorizov, Yury P. Zinchenko, Alexey V. Galatenko, Vladimir M. Staroverov, Sergey A. Isaychev, Vyacheslav V. Lebedev, Galina Ya. ... In rare cases (e.g., individual M14_A7), individual tuning slightly reduces reliability. ...

Еще в разделе: (Показать все результаты (>128) - www.psy.msu.ru/ )

• http://www.psy.msu.ru/science/psyrussia/2009/leonova.pdf
• http://www.psy.msu.ru/people/krivitsky/krivitsky2007a.pdf
• http://www.psy.msu.ru/science/psyrussia/2012/isaychev.pdf

... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...

Еще в разделе: (Показать все результаты (>5) - srd.sinp.msu.ru/ )

... Квантовая теория . ... КВАНТОВАЯ ТЕОРИЯ ПОЛЯ [7-й-8-й семестры] (проф. СЛАВНОВ Д.А.) . ... СОВРЕМЕННЫЕ ТЕОРЕТИЧЕСКИЕ ПРОБЛЕМЫ ФИЗИКИ ВЫСОКИХ ЭНЕРГИЙ [10-й семестр] (с.н.с. САМОХИН А.П.) . ... проф. СЛАВНОВ Д.А. Квантовая теория поля описывает фундаментальные законы современной физики. ... Квантовая теория поля является теоретической основой физики высоких энергий и физики элементарных частиц. ... Квантовая теория поля и физика фундаментальных взаимодействий. ... Введение в квантовую теорию поля. ...

Еще в разделе: (Показать все результаты (>5) - hep.phys.msu.ru/ )

Effective Algorithm of Charge State Determination in Electrospray Ionization Fourier Transform Ion Cyclotron Resonance Mass Spectra of Humic Substances Erast V. Kunenkov1, Andras Gaspar2, Alexey S. Kononikhin3, Philippe Schmitt-Kopplin2, Irina V. Perminova1 ... ESI FTICR mass spectrum of HS contains about ten thousands of peaks in mass range 250­1200 Da (the most intensive peaks are usually located near 400 Da) with tenths of peaks, appeared at each nominal mass with high regularity. ...

Еще в разделе: (Показать все результаты (>56) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2009/2009-kunenkov-total.pdf
• MGUMUS -- Kirk Hatfield

... Студенческая Астрономическая обсерватория ГАИШ . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... For those really interested in galaxies, extragalactic astronomy or the aspects of cosmology we study, we can always find an interesting problem to work on. ... To make your work in the Group most effective, it would be useful to study the following courses read by our group members as well as the members of other groups in our and other institures. ... Student information . ...

Еще в разделе: (Показать все результаты (>14) - www.sai.msu.ru/ )

• Отдел внегалактической астрономии: ГАИШ Extra-galactic astronomy Group Staff
• Отдел внегалактической астрономии: ГАИШ Отдел Внегалактической астрономии

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>6) - iconolat13.phys.msu.ru/ )

• Program topics
• Symposia

ВМиК-Online! ... Факультет . ... Кафедры . ... Лаборатории факультета ВМиК МГУ . В настоящее время на факультете работают 19 лабораторий, лишь три из которых имеют собственные сайты: . ... зав. профессор Ю.М.Баяковский . ... тел.: (495) 939-01-90 . ... зав. профессор В.И.Дмитриев . ... зав. профессор А.С.Ильинский . ... зав. профессор В.М.Пасконов . ... зав. профессор Б.М.Щедрин . ... зав. профессор Вячеслав Анатольевич Трофимов . ... зав. профессор Владимир Георгиевич Ушаков . ... зав. ...

Еще в разделе: (Показать все результаты (>13) - www.cmc-online.ru/ )

• ВМиК - Online! : Новости - На факультете ВМиК началась неделя GraphiCon?2003

... Surface sputtering and modification for collisions of Arn (n $ 100) cluster ions, with kinetic energies of 12­54 eV/atom, and slow highly charged ions (HCI), with potential energies of 80­3500 eV, have been simulated. ... Instr. and Meth. in Phys. Res. ... B xxx (2005) xxx­xxx 5 5. ... Surface erosion of a Si, Cu and Ni (1 0 0) surfaces by low energy HCI bombardments has been modeled by studying interactions of slow Xeq+ ions and the results of this simulation were compared with the experimental...

Еще в разделе: (Показать все результаты (>84) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/LIIWM/pre83_056707-Kho.pdf
• http://danp.sinp.msu.ru/LIIWM/Munteanu.pdf
• http://danp.sinp.msu.ru/LIIWM/ArXiv-0904.2151v1_Khodyrev2009.pdf

... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... We present the simulation framework CRPropa version 3 designed for efficient development of astrophysical predictions for ultra-high energy particles. Users can assemble modules of the most relevant propagation effects in galactic and extragalactic space, include their own physics modules with new features, and receive on output primary and secondary cosmic messengers including nuclei, neutrinos and photons. ...

Еще в разделе: (Показать все результаты (>11) - uhecr.sinp.msu.ru/ )

Computation of multiple eigenvalues and generalized eigenvectors for matrices dependent on parameters arXiv:math-ph/0502010 v1 2 Feb 2005 Alexei A. Mailybaev Abstract The pap er develops Newton's method of finding multiple eigenvalues with one Jordan block and corresp onding generalized eigenvectors for matrices dep endent on parameters. It computes the nearest value of a parameter vector with a matrix having a multiple eigenvalue of given multiplicity. ... m be eigenvalues of the matrix A0 . ...

Еще в разделе: (Показать все результаты (>29) - mailybaev.imec.msu.ru/ )

• Curriculum Vitae of Dr Alexei A

... Сектор информатики и биофизики сложных систем . ... О секторе . ... Учебная работа сектора включает лекции, семинары, практические занятия по информатике и математическому моделированию в биологии, биофизике, экологии на всех 5-ти курсах обучения на кафедре биофизики. ... Диффузия и взаимодействие белков в биологических мембранах? консультанты Ризниченко Г.Ю. , Рубин А.Б. Рабочие семинары сектора информатики и биофизики сложных систем проходят по четвергам в 11:00 в аудитории 124 (компьютерный класс...

Еще в разделе: (Показать все результаты (>8) - www.biophys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus
• Nhunt

A full system of equilibrium differential equations for the finite number of suspension lines (n = 28) of square parachute is derived. ... One can determine the shapes of inflated canopy radial cross-sections, stress distribution of radial ribbons on the canopy surface and fabric stress between them, drag coefficients for various line lengths and air-permeability by means of computer simulation. ... Initially, this problem was solved assuming D p = const over total canopy of square parachute. ...

Еще в разделе: (Показать все результаты (>7) - margaret.imec.msu.ru/ )

... Biological Faculty . Moscow State Lomonosov University . ... EDUCATION : B.S. Lomonosov Moscow State University, 1971 Physics . M.S. Lomonosov Moscow State University, 1972 Biophysics . Ph.D. Lomonosov Moscow State University, 1978 Biophysics . ... Lomonosov Moscow State University, 1990 Biophysics . ... 1972-1978 Research assistant Lomonosov State University, Moscow . ... Mathematical modelling in biology, . ... Lecturer at Biological Faculty, Lomonosov State University, Moscow . ...

Еще в разделе: (Показать все результаты (>3) - biophys.msu.ru/ )

ON-LINE VISUALIZATION OF SPEECH ORGANS USING MRI: A 3D APPROACH TO SPEECH ARTICULATION MODELING G. Ye. ... A stroboscopic method of data acquisition was used to reconstruct real articulatory processes for each speech stimulus. ... Thus collected animated data could be exposed for improved teaching and learning foreign languages' (in our case, the Russian language) technology, as well as for speech synthesis based on a physiologically relevant articulatory model. ... Figure 1. ...

Еще в разделе: (Показать все результаты (>122) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~rlc2010/abstracts/rlc2010_abstracts_sem26.pdf
• http://www.philol.msu.ru/~otipl/SpeechGroup/publications/2004/z-7.doc
• http://www.philol.msu.ru/~rkigf/P_Objavlenija/Konferencii/Konferencii_2011/2011_09_Grec_form2011.pdf

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>24) - mph.cmc.msu.ru/ )

• MPH-CMC-MSU

Draft Dr. Paul Twomey President and Chief Executive Officer Internet Corporation for Assigned Names and Numbers (ICANN) Speech to Third International Forum Partnership Among State, Business Community and Civil Society in Ensuring Information Security Garmisch-Partenkirchen, Germany Monday, 20 April 2009 Dear Vladislav Petrovich, Dear Alexei Anatolievich, Distinguished guests, Ladies and Gentlemen. ... ICANN itself is evolving, mirroring the changing nature of the global Internet community. ...

Еще в разделе: (Показать все результаты (>9) - iisi.msu.ru/ )

... Крол Э. Все об Internet. Киев: BHV, 1995. 591с. Кент П. Internet. М.: Компьютер, 1996. 368с. Кент П. World Wide Web. М.: Компьютер, 1996. 312с. Хоникатт Дж. Internet Windows-95. М.: Бином, 1996. 334с. Хоникатт Дж. Использование Internet. ... СПб.: 1997. 185с. Айзекс С. Dynamic HTML. СПб.: ... BHV, 1998. 1040с. Ланг К., Чоу Д. Публикация баз данных в Интернете. ... М.: Бином, 1996. 336с. Бакулин П.И., Кононович Э.В., Мороз В.И. Курс общей астрономии. ...

Еще в разделе: (Показать все результаты (>13) - heritage.sai.msu.ru/ )