Dmitry Karpov . Dmitry Karpov was born in Moscow, Russia. ... Dmitry Karpov studied mechanisms of formation of the valence band in the water Raman Scattering (RS) spectrum. In particular, he focused on (1) the effect of the ion hydration type change due to the temperature variation on the valence band shape in the water RSS and (2) the study of the Fermi resonance role in the formation of the valence band in the water RSS by using the RS temperature dependence. ...

Еще в разделе: (Показать все результаты (>67) - rswater.phys.msu.ru/ )

• Laboratory of laser spectroscopy of solutions of supramolecular compounds and
• Лаборатория лазерной спектроскопии растворов супрамолекулярных соединений и

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Moscow State University, Sternberg Astronomical Institute . ... Moscow State University, Sternberg Astronomical Institute, Cremian Laboratory . Dr. Vladimir Amirhanyan - Soft, Radioobservations, Interpretations . Sternberg Astronomical Institute . Aleksandr Belinskiy - mechanics, soft, observations, interpretation . ... Mikhaylo Kuznecov - mechanics, soft, observations, interpretation . ... Moscow State University, Physics Department . ... Gleb Antipov - observations, interpretation . ...

Еще в разделе: (Показать все результаты (>34) - observ.pereplet.ru/ )

• MASTER GLOBAL ROBOTIC TELESCOPES NET
• MASTER ROBOTIC NET

Название статьи И.О. Фамилия11,a, И.О. Фамилия22,b 1 Название института и полный адрес, например: Московский государственный университет имени М.В.Ломоносова, физический факультет, кафедра общей физики. ... Title in English I.O. Pervyiavtor1,a , I.O. Vtoroiavtor2,b 1 Название института и адрес на английском языке, например: Department of [.. ... Moscow 119991, Russia. 2 Название института и адрес на английском языке, например Sternberg State Institute of Astronomy, Moscow State University. ...

Еще в разделе: (Показать все результаты (>9) - waves.phys.msu.ru/ )

Ionization Dynamics of Atoms Exposed to Strong Laser Pulses: Semi­Analytical Model at Low Field Frequencies Yu.V. Popov Skobeltsyn Institute of Nuclear Physics, Lomonosov Moscow State University Collaboration B. Piraux, A. Hamido. ... INTRODUCTION AND MOTIVATIONS Keldysh has introduced the adiabaticity parameter = (2Ip)1/2/E where is the laser field frequency, E, the field amplitude, and Ip the ionization potential of the atom. ... Both of them, multiphoton processes and tunnel ionization play a role. ...

Еще в разделе: (Показать все результаты (>13) - lmmqsp.sinp.msu.ru/ )

• http://lmmqsp.sinp.msu.ru/mat/poster_Mult_Ion_2013.pdf
• http://lmmqsp.sinp.msu.ru/mat/Present_Metz_popov.pdf
• http://lmmqsp.sinp.msu.ru/mat/poster_neutrino_2013.pdf

... Institute for Solid State Physics has a solid tradition of preparing students for advanced degrees and successful careers. The high quality of scientific researches performed in the ISSP is mostly due to thorough and industrious training of scientific personnel. The departments of the Moscow Institute for Physics and Technology , Faculty of Physics of M.V.Lomonosov Moscow State University and Moscow Institute of Steel and Alloys work closely with our Institute. ... e-mail: univer issp.ac.ru . ...

Еще в разделе: (Показать все результаты (>58) - www.issp.ac.ru/ )

• Pod-Moscowny Branch of Moscow University in Chernogolovka, Home page
• EAAS - old "Welcome page"
• Chair of MIPT in ISSP RAS, Chernogolovka

THE FIRST JAPAN-RUSSIA MEDICAL FORUM PROGRAM Date: December 10, 2012 Venue : Intellectual Center - Fundamental Library of Lomonosov Moscow State University Bld.27, Lomonosovskiy prospect, Moscow , 119991, Russia Organizers: Lomonosov Moscow State University Tohoku University Supported by Embassy of ...

Еще в разделе: (Показать все результаты (>2483) - fbm.msu.ru/ )

• http://www.fbm.msu.ru/upload/conf/20110201/Information_letter_2011_eng.pdf

. Область научных интересов . Сотрудники, приглашенные специалисты и студенты . Информация о научных конференциях и семинарах . Основные публикации . Наш адрес . Home page .

Еще в разделе: (Показать все результаты (>64) - www.srcc.msu.ru/ )

SUNY-MSU Partnership . ... MSU | ... The State University of New York/Moscow State University partnership dates back to the mid-1970s and owes its existence to the vision of then MSU Rektor Rem Kokhlov and SUNY Chancellor Ernest L. Boyer. ... The first students were exchanged in 1977. ... A SUNY Center on Russia and the United States opened its doors in January 2000, and a sister MSU Center on the United States and Russia was set up in Moscow at MSU?s newly built Science Park. ... suny-msu . ...

Еще в разделе: (Показать все результаты (>2) - www.suny.msu.ru/ )

• SUNY-MSU: Center on Russia and the United States

... UHECR SINP MSU . ... TUS . ... mini-EUSO (UV atmosphere) . News . UHECR news . TLE news . Lab's news . Publications . Publications UHECR . ... For students . Our students . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . JEM-EUSO Extreme Universe Space Observatory on the Japanese Experiment Module (JEM) of the International Space Station . ... JEM-EUSO is a new type of observatory that uses the earth's atmosphere as a detector. ...

Еще в разделе: (Показать все результаты (>39) - uhecr.sinp.msu.ru/ )

• Lab's students
• Publications UHECR
• Ultra high energy cosmic ray detector KLYPVE on board the Russian Segment of

МГУ имени М.В.Ломоносова Русская версия . ... Sociology . ... Chairman Dean of the Faculty of Sociology of the Lomonosov Moscow State University, Doctor of Sociology , Professor Osipova N.G. Vice-Chairman Vice-Dean for Science of the Faculty of Sociology of the Lomonosov Moscow State University, Candidate of Political Sciences, Associated Professor Kanevskiy P.S. Executive secretary Chairman of the Young Scientists Council of the Faculty of Sociology of the Lomonosov ...

Еще в разделе: (Показать все результаты (>11729) - conf.msu.ru/ )

• пҐяЂпёяЃя‚пѕя„пѕяЂ пђпЅпґяЂпµпµпІпёя‡ п­яЂп°пјп¶яЏпЅ / пњп“пе пёпјпµпЅпё
• Ульяна Анатольевна Громова / МГУ имени М.В.Ломоносова
• Anna - / МГУ имени М.В.Ломоносова

. ИМЕЕТСЯ РУССКАЯ ВЕРСИЯ . Moscow State University . Chamber Orchestra . founded in 1967 by Edward Gindin . music director, Alexander Konstantinov . About the Orchestra . MEMBERS: . 201 5 /201 6 season . Alia . RECITALS: . Concert Schedule . Audio/Video Records . Some Other Interesting Sites . Natalya Atsarkina , site administrator ( e-mail: azarkina@yahoo.com ) . The homepage was founded in September, 1999 . Lastly updated in March 22, 201 6 . This site is a member of WebRing. To browse visit Here .

Еще в разделе: (Показать все результаты (>22) - music.genebee.msu.ru/ )

ANTARES Collaboration Meeting . ... Group photo in front of Lomonosov monument and MSU Main Building . ... We are pleased to welcome you to Moscow State University, where June 6-10, 2011 the ANTARES Collaboration Meeting will be held. Moscow State University is one of the tourist attractions of Moscow, an architectural monument and the tallest university building of the world. ... Antonio Capone, Physics Department University "Sapienza" and INFN, Roma . ... Salvatore Mangano, IFIC-CSIC, Valencia . ...

Еще в разделе: (Показать все результаты (>22) - antares.sinp.msu.ru/ )

... Faculty of Physics . M.V.Lomonosov Moscow State University . 7 (495) 939-16-82 info@physics.msu.ru . ... Contacts . ... Research Centers . ... Search Faculties Staff . Education . ... Research . ... Education research . ... Calendar / Calendar . ... 7 495 939-16-82, . ... Faculty of Physics, 2016 . ... the Ministry of Education and Science . ... official site <div><img src="https://mc.yandex.ru/watch/35023620" style="position:absolute; left:-9999px;" alt="" /></div> ...

Еще в разделе: (Показать все результаты (>88) - www.phys.msu.ru/ )

• Giving to the Faculty
• Library of the Faculty of Physics
• Faculty Staff

SEMINAR Singular Perturbations and Time Scales (SPaTS) in Control Theory and Applications 14:30 PM, Saturday, June 23, 2012, Room 5-18 Faculty of Physics, M.V. Lomonosov Moscow State University , Moscow, Russia Professor D. Subbaram Naidu , PhD, PE, Fellow IEEE Director and Professor, School of Engineering Director, Measurement and Control Engineering Research Center Idaho State ...

Еще в разделе: (Показать все результаты (>197) - matematika.phys.msu.ru/ )

... Institute Laboratory-Chairs . ... Laboratory-chair of theory of space-time and interactions . ... Yuriy Sergeyevich Vladimirov , Doctor of Science (Physics and Mathematics), Professor, Leading Researcher, Division of Theoretical Physics, Faculty of Physics, Moscow State University, Moscow, Russia. ... Anton Vasil'yevich Solov'yov , Doctor of Philosophy (Physics and Mathematics), Researcher, Division of Theoretical Physics, Faculty of Physics, Moscow State University, Moscow, Russia. ...

Еще в разделе: (Показать все результаты (>1024) - chronos.msu.ru/ )

• Зверева И.М. (I. M. Zvereva)
• Prognosis of the State of Ecosystems and ...

Faculty of Global Studies, Lomonosov Moscow State Uiversity Information Sheet 2014- 2015 GENERAL INFORMATION University Website Faculty Website for Exchange Students Academic Guide for Exchange Students Mailing Address of the Faculty (for courier delivery as well) Contact Information of the international department of the Faculty http://www.msu.ru/ http://fgp.msu.ru/ http://fgp.msu.ru/ru/ ... The faculty provides exchange students with the dormitory. ...

Еще в разделе: (Показать все результаты (>3071) - fgp.msu.ru/ )

• Orfalea Center represented at ?Globalistics 2013? Congress in Moscow, Russia

International Laser Center of MSU . ... Home Science and education Scientific Laboratories Laboratory of solid-state lasers and coherent spectroscopy . ... The first experiments in the laboratory of solid-state lasers and coherent spectroscopy were done in 1974-1975 years. ... In 1980, the laboratory began more complex experiments on the base of picosecond lasers, namely experiments realizing nonstationary picosecond CARS of molecular gases (CARS-coherent antiStokes Raman scattering). ...

Еще в разделе: (Показать все результаты (>846) - ilc.phys.msu.ru/ )

• ILC MSU
• ICONO/LAT 2013 Best Student Paper Awards
• Laser Graduate School

. Windows CP1251 . Education . 1983-1989 Moscow State University. Physical Department. Chair of Geophysics. Diploma of physicists. Title of diploma "Model of orogenesis in terms of the conception of the two-stage plate tectonics" . (1989) . Supervisor - Dr. A.V.Karakin . 1973-1983 Secondary school. Moscow. Certificate. Page design: їV.Zakharov . E-mail: vszakharov@yandex.ru . Home page . Dynamic Geology . Geological Faculty

Еще в разделе: (Показать все результаты (>53) - dynamo.geol.msu.ru/ )

• Professional experience of V.Zakharov

... MBA . EXECUTIVE MBA . ... О Школе . ... Бакалавриат Магистратура МВА General MBA MBA-Производственные системы Executive MBA Краткосрочные и Executive Programs Doing Business in Russia . ВШБ МГУ - школе . ... Главная Программы Doing Business in Russia . Study the Russian business with Lomonosov Moscow State University Business School . The Doing Business in Russia was designed for Executive MBA and MBA students from abroad who are interested in the Russian market. ...

Еще в разделе: (Показать все результаты (>1679) - www.mgubs.ru/ )

• В газете The Northeastern Voice (Northeastern University) вышла статья про
• Высшая школа бизнеса МГУ им. Ломоносова
• Moscow Times о российских программах Executive MBA