... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . Regatta . ... Серия Blue Gene в мире . ... Факультет вычислительной математики и кибернетики МГУ . ... parallel.ru . ... Parallel Computing . ... Некоммерческое программное обеспечение Intel : . ... Часть ссылок и описаний к ним любезно предоставлена администратором сайта кафедры АНИ факультета ВМК МГУ имени М. В. Ломоносова . Факультет ВМК МГУ . ... 2008 2013 Факультет ВМК МГУ имени М. В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>2) - hpc.cs.msu.ru/ )

... These spectral characteristics compare with introduction (ВВЕДЕНИЕ) At last time many workers have studied thermal Rayleigh-Benard convection using numerical At last time many workers have studied thermal Rayleigh- Benard convection using numerical time many At last time many workers have studied thermal Rayleigh-Benard convection using numerical used spectral methods with periodic boundary conditions. ... In numerical simulations were derived secondary stationary, [pic] where ? ...

Еще в разделе: (Показать все результаты (>31) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2012/lectures/Yakhot-abstract.doc

... Кафедры . ... Krasnoslobodtsev V. P. Territorial availability of higher education in the Northern Caucasus. ... The Northern Caucasus with its relatively favorable demographic structure of population as compared to the rest of Russia is experiencing the profound growth in the availability of higher education. ... In 2007 90% of population of the Northern Caucasus lived within daily distance from higher schools providing mass and prestigious higher education (in law and economics, for example). ...

Еще в разделе: (Показать все результаты (>190) - www.geogr.msu.ru/ )

• Список литературы

... Дистанционное обучение . Learning and Teaching with the Web . ... Multimedia Educational Resource for Lerning and Online Teaching . ... Foreign Language Teaching Forum . Center for Enhancement of Teaching and Learning . Resources for Teaching . ... The European Association for Distance Learning . European Distance and e-Learning Network . ...

Еще в разделе: (Показать все результаты (>9) - anazarenko.ffl.msu.ru/ )

... Collaborative Research Center for Cluster Ion Beam Process Technology . ...

Еще в разделе: (Показать все результаты (>102) - danp.sinp.msu.ru/ )

. General Physics Chair, . Physics Department, MSU . Topics . Education . Demonstrations . Dear colleagues, . Here you can find the following: . Education: general physics course program. Demonstrations: computer demonstrations. Русская версия . 01 Nov, 2010 . Contacts .

Еще в разделе: (Показать все результаты (>23) - genphys.phys.msu.su/ )

• Публикации

http ://www.cbat.eps.harvard.edu/iau/cbet/003900/CBET003962.txt Electronic Telegram No.3962 Central Bureau for Astronomical Telegrams INTERNATIONAL ASTRONOMICAL UNION CBAT Director: Daniel W. E. Green; Hoffman Lab 209; Harvard University ; 20 Oxford St.; Cambridge, MA 02138; U.S.A. e-mail: cbatiau en eps.harvard.edu (alternate cbat en iau.org) URL http ://www.cbat.eps.harvard.edu/index.html Prepared using the Tamkin Foundation Computer Network SUPERNOVA ...

Еще в разделе: (Показать все результаты (>17) - observ.pereplet.ru/ )

• Observatory
• MASTER GLOBAL ROBOTIC TELESCOPES NET

... Continental Lithosphere Beneath SE Brazil . ... CREST (Continental Rifts: Evolution, Structure and Tectonics) Project . Crust and Upper Mantle Structure of S. California . ... Surface wave dispersion and upper mantle structure beneath southern Germany . ... Tomographic P-wave velocity inversion for the crust and upper mantle structure beneath Alaska . ... Upper Mantle Velocity and Q Structure . ... Velocity structure and anisotropy of the crust and upper mantle in the Brooks Range, Alaska . ...

Еще в разделе: (Показать все результаты (>9) - sbmg.geol.msu.ru/ )

• Calendar Converter

... Исследователи химического факультета МГУ представили проект моделирования молекулярной динамики опасных вирусов . ... Владимир Пентковский, известный разработчик программно-аппаратных архитектур, заслуженный исследователь Intel, обладает большим опытом создания научных коллективов в России, США и Индии. ... 2003 2011 MsuNews.Ru Новости МГУ . ... Экспорт новостей (RSS) ...

Еще в разделе: (Показать все результаты (>64) - www.msunews.ru/ )

• MsuNews.Ru | Новости МГУ | Профессор Стэнфордского университета рассказал
• MsuNews.Ru | Новости МГУ | Команда МГУ имени М.В. Ломоносова лидирует на
• MsuNews.Ru | Новости МГУ | Суперкомпьютер 'Ломоносов' Московского университета

... Up: Человек против Бога Previous: 3. ... Человек против Бога . This document was generated using the LaTeX 2 HTML translator Version 96.1 (Feb 5, 1996) Copyright ї 1993, 1994, 1995, 1996, Nikos Drakos , Computer Based Learning Unit, University of Leeds. ... The translation was initiated by Lipunov V.M. on Sat Jan 9 14:41:03 MSK 1999 . Lipunov V.M. Sat Jan 9 14:41:03 MSK 1999 . Copyright (c) "Русский переплет" . ...

Еще в разделе: (Показать все результаты (>164) - www.pereplet.ru/ )

• Super Ratio
• News of Russian Science

The Laboratory of the Historical Information Science . ... The historical information science laboratory was founded within the structure of the source studies department on 8 December 1995 for the purpose of fulfilling the decision of the academic council of the History Faculty of 4 October 1991 about the transformation of a group for the application of mathematic methods and mainframes in historical research in the laboratory of historical information sciences. ... Senior laboratory assistant (2) . ...

Еще в разделе: (Показать все результаты (>11) - www.hist.msu.ru/ )

• Textbooks and teaching aids
• Library systems

... The factors that play the key role in complex formation are as follows: the rate of protein diffusion to the docking site; long-range electrostatic interactions between protein surfaces, geometric and chemical complementarity of binding areas; molecular mobility at the protein­protein interphase, hydrogen bonds, Van der Waals interactions, hydrophobic interactions, and salt bridges. ... Three-dimensional protein molecules are constructed on the basis of data extracted from the Protein Data Bank. ...

Еще в разделе: (Показать все результаты (>29) - www.library.biophys.msu.ru/ )

• http://www.library.biophys.msu.ru/PDF/80551.pdf
• НЕЛИНЕЙНЫЕ ВОЛНЫ В ДНК. АНАЛИТИЧЕСКИЕ ИССЛЕДОВАНИЯ И КОМПЬЮТЕРНОЕ МОДЕЛИРОВАНИЕ

Prof. A.Nekipelov Moscow School of Economics , Moscow State University Lomonosov The Concepts of Economic Growth and Economic Development: Standard Macroeconomics and Pure Economics Approaches A Lecture Presented on January 31, 2011 at the International School f or Students Organized by IASSA and Department of Computational Mathematics and Cybernetics, MSU Lomonosov Economic Growth and Its Measurement by ... This distinction is applicable to the field of economic investigation. ...

Еще в разделе: (Показать все результаты (>13) - www.mse-msu.ru/ )

docs ]] . CompHEP . Trace: docs . ... E.E.Boos, M.N.Dubinin, V.A.Ilyin, G.V.Jikia, A.E.Pukhov, S.F.Sultanov, Associated Higgs boson production in $\gamma e$ collisions, Puzzles on the Electroweak Scale. ... E.E.Boos, M.N.Dubinin, V.F.Edneral, V.A.Ilyin, G.V.Jikia, A.E.Pukhov, V.I.Savrin, S.A.Shichanin, S.F.Sultanov, Physics on future $\gamma p$ and $\gamma e$ colliders at TeV energy scale and computer system CompHEP, DESY report 91-114, Hamburg, 1991, 24p . ... Higgs boson production . ...

Еще в разделе: (Показать все результаты (>20) - comphep.sinp.msu.ru/ )

• overview [CompHEP]

... With the usage of on-land and satellite altimetrical measurements data some gravity map were made, averaged on one degree trapeziums, in reductions Faja, Bouguer, Glenni, which were included in the geological-geophysical international atlases of Atlantic, Indian and Pacific oceans. ... Boldirev S.A., Gajnanov A.G., Stroev P.A. Dencital inhomogeneities in lithosphere and dynamics of development of the North-West part of the Pacific mobile belt. ... Moscow, Nedra edition, 1967. ...

Еще в разделе: (Показать все результаты (>55) - geophys.geol.msu.ru/ )

• Near-surface electrical prospecting laboratory at Moscow University
• Researchs
• TES tecnology. MSU.

Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...

Еще в разделе: (Показать все результаты (>7) - lvk.cs.msu.su/ )

... My field of specialization is Stability Theory, Nonlinear Dynamics, Asymptotic Methods, Mechanics of Solids, System Identification, Optimal Control, Economic Growth. ... A.O. Belyakov and A.P. Seyranian (2012). ... A.O. Belyakov and A.P. Seyranian, . ... A.P. Seyranian and A.O. Belyakov, Swing dynamics. ... A.O. Belyakov, A.P. Seyranian, and A. Luongo, Regular and chaotic dynamics of the swing. 6th EUROMECH Nonlinear Dynamics Conference (ENOC 2008) , Saint Petersburg, Russia, June, 30 - July, 4 2008...

Еще в разделе: (Показать все результаты (>11) - belyakov.imec.msu.ru/ )

. Our Atlas server news 1 (Feb 06, 2008) [Rus, utf-8] .

Еще в разделе: (Показать все результаты (>9) - lhe.sinp.msu.ru/ )

... T. A. Dolenko, S. A. Burikov, K. A. Laptinskiy, and O. E. Sarmanova, Improvement of the fidelity of molecular DNA computations: control of DNA duplex melting using Raman spectroscopy, Laser Physics, v. 26, No 2 Jessica M. Rosenholm, Igor I. Vlasov, Sergey A. Burikov, Tatiana A. Dolenko, and Olga A. Shenderova. ... A.O. Efitorov, S.A. Burikov, T.A. Dolenko, I.G. Persiantsev, S.A. Dolenko. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>30) - rswater.phys.msu.ru/ )

• Лаборатория лазерной спектроскопии растворов супрамолекулярных соединений и