Home . Data . ... Meteor-M тДЦ1 . ... Meteor-M тДЦ2 . ... Solar energetic particles . ... Solar flare database (RU) . ... Space Monitoring Data Center of SINP MSU (SMDC) collects the data of space experiments as well as scientific and applied models for studying the geomagnetic and radiation conditions in the near-EarthтАЩs space environment. ... Latest data from featured spacecrafts . Meteor-M #1 is alive! ... Space weather now . ... NOAA N3KL Solar Activity Monitor . ... Developed in 2007. ...

Еще в разделе: (Показать все результаты (>27) - smdc.sinp.msu.ru/ )

• Space monitoring data center

... Faculty of Soil Science, Moscow State University . ... Evaluation of acid deposition effects on soils as a component of forest ecosystems. ... Estimation and prediction of forest soil response to acid deposition with simple process-based models. ... Forest soil response to acid deposition, in particular the significance of soil organic matter in the processes of proton consumption, sulphur retention, aluminium and heavy metals mobilisation was investigated. ... Acid Deposition and Forest Soils. ...

Еще в разделе: (Показать все результаты (>19) - eco.soil.msu.ru/ )

• SIMULATION OF ACID SNOW AND RAIN IMPACT ON FORESTS
• LONG-TERM RESPONSE OF FOREST SOILS TO ACID DEPOSITION
• Polluting metals in Russian terrestrial ecosystems: chemistry, dynamics, and

... Проводится запись на очные курсы СУНЦ МГУ на 2011-12 учебный год . ... ФМШ.ру - обучение одаренных детей . ... Математика (часть 1)' - оригинальный курс математики из 74 уроков. ... Научный руководитель проекта - доцент кафедры математики СУНЦ МГУ, к.ф.-м.н. Дубровский В.Н.. ... Егоров А.А., зав. отделом математики редакции журнала "Квант", преподаватель СУНЦ МГУ, . ... 01.12.2011 Сегодня нашей школе исполняется сорок восемь лет.. ... СУНЦ МГУ школа им. А.Н.Колмогорова . ...

Еще в разделе: (Показать все результаты (>6) - www.pms.ru/ )

... CONV_MSU, , PLOOK, MergeBIN. 1. , () () , . ... HEX; HEX- ; HEX- « » EXD; EXD-; EXD- «» ; ­ EXT; EXD/EXT- d / e PLOOK; 03 06 EXT-; EXT- PL2, PLOOK v1.4, SatMSU-250 . ... 2. b. c. d. e. f. g. h. 3. a, c e CONV_MSU ( MergeBIN) BAT-, DOS- Windows. ... HEX- - ( HEX); k. 3_CheckDT.bat EXD-; DateTime.log, , HEX- f; l. PLOOK ( eval\ ), , , EXD-; m. 4_EXDtoEXT.bat . ... BIN->HEX); ; (HEX->EXD); EXD-; (EXD->EXT); 03 ; PL3 03 ; 06 ; PL3 06 ; (). v.2005/06/27 docs\: HowTo_CONV_MSU.pdf ­ ( ); 3 HEX- 1. ... BAT-...

Еще в разделе: (Показать все результаты (>55) - cosmos.msu.ru/ )

... Microstructure deeply influences the properties and thus the functionality of a material. In an X-ray diffraction pattern, the microstructure information is usually extracted from the breadth and shape of line profiles. ... Доклад ?Structure/microstructure and their interplay in nanomaterials and layered systems? оказался очень полезным и интересным для ученых, работающих в области неорганического синтеза и физико-химических методов исследования. ...

Еще в разделе: (Показать все результаты (>14) - nano.msu.ru/ )

Poligraphic complex (printing plant) - humanitarian aid from RRU to South Ossetia A.A. Tibilov State University The printing plant is intended to make a wide range of materials - textbooks, manuals, presentations, reports, informational and commercial printed matters. ... wide color range, surpassing that of offset printing; . ... simple operation and high reliability. [pic] Besides the printer, there is a digital color copier Duplo DPS850 (Japan) size A3, in the printing complex. ...

Еще в разделе: (Показать все результаты (>35) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/327.doc

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• ConClus

Russian Journal of Coordination Chemistry, Vol. ... The Molecular Mechanic Approach to Coordination Compounds: Force Field Based on the Gillespie-Kepert Model . ... Abstract - The set of parameters for calculating the geometry of coordination compounds is suggested on the basis of the molecular mechanic approach complemented by the Gillespie-Kepert model. ...

Еще в разделе: (Показать все результаты (>25) - analyt.chem.msu.ru/ )

• Ссылки для изучения студентам, предполагающим делать курсовую работу в группе
• Moscow State University: Analytical Chemistry Division

RAS-DOE project #RUC2-20006-MO-04, 2004-2007, PI: Perminova I.V. Investigation and Modeling of the Fundamental Interactions of Actinides with Customized Humic Substances at both the Molecular and Colloidal Levels . ... This proposal addresses the fundamental interactions between actinides and materials genetically classified as humic substances. ... The research will probe the interactions between these actinides and a comprehensive group of well-characterized, "designer" humic substances. ...

Еще в разделе: (Показать все результаты (>116) - mgumus.chem.msu.ru/ )

• MGUMUS -- Researches

... Предыдущее сообщение: PARALLEL.RU - Новости, выпуск #263 [14/04/2009] . ... НОВОСТИ МИРА ВЫСОКОПРОИЗВОДИТЕЛЬНЫХ ВЫЧИСЛЕНИЙ http :// parallel.ru / news / + NVIDIA предоставляет пользователям OpenCL Driver. http ://www.nvidia.com/object/io_1240224603372.html + Psychsoftpc выпускает Psychlone Tesla Personal Supercomputer. http ://www.psychsoftpc.com/psychlone_tesla.htm + NSF финансирует участие 14 университетов в программе IBM/Google Cloud Computing University Initiative. http ://www.nsf.gov/ news...

Еще в разделе: (Показать все результаты (>321) - mail.parallel.ru/ )

• PARALLEL.RU - Новости, выпуск #272 [29/09/2009]
• PARALLEL.RU - Новости, выпуск #266 [27/05/2009]
• PARALLEL.RU - Новости, выпуск #261 [18/03/2009]

Lessons learned from the Thirty Meter Telescope site testing Tony Travouillon Sebastian Els, Angel Otarola, Reed Riddle, Matthias Schoeck, Warren Skidmore TMT.XXX.PRE.05.0XX.DRF01 1 Introduction TMT and its Site testing. Important choice before going on site. ... Considerations during analysis of the data. TMT.XXX.PRE.05.0XX.DRF01 2 Some Background about the TMT Site Testing TMT is a 30m, segmented, RitcheyChretien telescope design. ... ASCA Cloud Cover Analysis So how do we do it in practice? ...

Еще в разделе: (Показать все результаты (>18) - site2010.sai.msu.ru/ )

• http://site2010.sai.msu.ru/static/doc/GHerriot_site2010.ppt.pdf
• http://site2010.sai.msu.ru/static/doc/BSafonov_site2010.pdf
• http://site2010.sai.msu.ru/static/doc/VNosov_site2010.pdf

PHYSICAL REVIEW E 83, 056707 (2011) Shower approach in the simulation of ion scattering from solids V. A. Khodyrev,1,* R. Andrzejewski,2 A. Rivera, 1 3 2, D. O. Boerma,2 and J. E. Prieto2, 3, Institute of Nuclear Physics ... Madrid, ES-28049 Madrid, Spain (Received 7 May 2010; revised manuscript received 24 March 2011; published 16 May 2011) An efficient approach for the simulation of ion scattering from solids is proposed ... 056707-4 SHOWER APPROACH IN THE SIMULATION OF ION .. ...

Еще в разделе: (Показать все результаты (>89) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/Articles_GSIB/nimb_GCIB_Ar_Smoothing_Swenson.pdf
• http://danp.sinp.msu.ru/pci2012/vecher29_stend.pdf
• http://danp.sinp.msu.ru/LIIWM/ArXiv-0904.2151v1_Khodyrev2009.pdf

... Run program . User's guide . Launching program . Input data format . ... Selecting the number of correlated pairs . ... In order to run thr program one needs Java 5.0 environment. ... At the end of computations one will be asked to review the selected number of correlated pairs. ... Note: One may redefine the number of correlated pairs by selecting the 'Edit' -> 'redefine correlated pairs number' menu item. Correlated pairs of positions are presented as a colored matrix, the heatmap. ...

Еще в разделе: (Показать все результаты (>8) - bioinf.fbb.msu.ru/ )

• SDPpred

Uneex . SeminarFeature . ... Определение спама как нежелательной почты в противовес массовой рассылке . Классические методы защиты от спама и их недостатки . ... Методы, основанные на поведении спамера: Greylisting , TMDA и т. п. Основной источник спама, обходящего классические методы защиты . ... Общая схема построения (feature-based) классификаторов . ... Copyright 2003 by the contributing authors. ... Send feedback to svv at cmc dot msu dot ru. ...

Еще в разделе: (Показать все результаты (>13) - uneex.cs.msu.su/ )

• Uneex . LecturesFirst2004
• Журнал д-ра Добба, Январь-Февраль 1996, N 1(13)
• TWiki . Uneex . LecturesFirst2004

Setting Up a Pay System Canada Business Service Centres - CBSCs Last Verified: 2004-05-28 Document No. 4046 Summary Pay administration is a management tool that enables you to control personnel cost, increase employee morale, and reduce work force turnover. ... This publication provides time-tested concepts for determining competitive pay levels and for maintaining fair pay relationships among the jobs comprising a small company. ... appraise employee performance under the plan. ... job title; . ...

Еще в разделе: (Показать все результаты (>16) - innovation.msu.ru/ )

• Process of Forming a Company - Discussion Question

... Chemical Enzymology Department, Chemical Faculty . ... 7 (495) 939-31-70, Fax: +7 (495) 939-31-70, +7 (495) 939-54-17 . ... Strong background in Chemistry (Biochemistry, Organic chemistry, Analytical chemistry, Inorganic chemistry, Physical chemistry, Chemistry of polymers), biochemistry, chemical technology, molecular biology, Physics (course of Theoretical physics, the Theoretical mechanics); . ... II) other fields: biotechnology, immobilized cells, microbiology . ... Enzymology Department ...

Еще в разделе: (Показать все результаты (>113) - www.enzyme.chem.msu.ru/ )

• Gudkov D.A.
• Учебный процесс

... Правила проведения зимней экзаменационной сессии на геологическом факультете МГУ . ... Курс ориентирован на освоение студентами основных методов работы на компьютере и различных периферийных устройствах (принтеры, плоттеры, сканеры, дигитайзеры и т.д.), знакомство с существующими ... так и общего назначения) для решения конкретных геологических задач (построение различной геологической графики, работа с базами данных , моделирование геологических процессов, оформление отчетов, статей и т.п.) ...

Еще в разделе: (Показать все результаты (>4) - geol.msu.ru/ )

... В лабораторных работах с использованием программной модели WPF надо создать пользовательский интерфейс для работы с данными классов из лабораторных работ предыдущего семестра. ... Элементы XML. ... Синтаксис элемент-свойство для коллекций. ... Класс ItemsControl - базовый класс элементов управления для работы с коллекцией. ... Классы архитектуры элемента управления DataGrid в WPF. ... Создание пользовательского интерфейса приложения с использованием классов WPF для классических элементов управления....

Еще в разделе: (Показать все результаты (>4) - lmph.cmc.msu.ru/ )

Journal of Cell Science 112, 2277-2289 (1999) Printed in Great Britain © The Company of Biologists Limited 1999 JCS0417 2277 Contribution of plus and minus end pathways to microtubule turnover I. A. Vorobjev1, V. I. Rodionov2, I. V. Maly1 and G. G. Borisy2,* 1Laborator 2Laborator y of Cell Motility, A. N. Belozersky Institute, Moscow State University, Moscow, Russia y of Molecular Biology, University of Wisconsin, 1525 ... Distal (plus) ends of MTs displayed dynamic instability. ...

Еще в разделе: (Показать все результаты (>25) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/komarova2002.pdf
• http://cellmotility.genebee.msu.ru/html/articles/grigoriev97.pdf