... Newsgroups: sci.astro,sci.space.tech,sci.space.science,sci.space.shuttle,sci.answers,news.answers . Subject: Astro/Space Frequently Seen Acronyms . ... Acronym List for Space and Astronomy . ... Note that this is intended to be a reference for frequently seen acronyms, and is most emphatically not encyclopedic. ... Anglo-Australian Observatory . ... Astronomical Image Processing System . ... American National Standards Institute . ... Data Relay Satellite . ... List of Frequently Seen Acronyms (!) ...

Еще в разделе: (Показать все результаты (>89) - www.kosmofizika.ru/ )

• Institute of Solar-Terrestrial Physics RAS SB
• CREATION AND DESTRUCTION OF THE SOLAR PROTON BELTS IN THE INNER MAGNETOSPHERE
• CURRICULUM VITAE

Announcement On November 2-3, 2005 Lomonosov Moscow State University will conduct jointly with the Academy of Cryptography of the Russian Federation the Fourth All- Russian Conference Mathematics and Security of Information Technologies [Cybersecurity?] and jointly with the Center of International Studies, Cambridge University , United Kingdom, Advanced Research Workshop Unconventional ... Sherstyuk V.P. - Security Council of the Russian Federation; 3. ... Organization Committee 1. ...

Еще в разделе: (Показать все результаты (>27) - suny.msu.ru/ )

• http://suny.msu.ru/ru/ProgramMaBIT05En.doc
• Center on Russia and the United States :: Other Russian Programs
• Центр по делам России и США :: Другие проекты в России

... On the Institute . ... Development of relational methods of studying time [Chief: V.V. Aristov, Dr. Sci. (physics and mathematics)] . ... Physics of relic radiation, fundamental interaction mediator, carrier of space and time [Chief: I.M. Dmitrievsky, PhD (technology), Ass. ... Algebraic structure of space-time, algebrodynamics of fields and particles [Chief: V.V. Kassandrov, PhD (physics and mathematics)] . ... Causal mechanics [Chief: S.M. Korotaev, Dr. Sci. (physics and mathematics)] . ...

Еще в разделе: (Показать все результаты (>21) - temporology.bio.msu.ru/ )

• Russian Roulette / Русская Рулетка

. [ Войти ] . Главная -> Фильмы -> The American Film Institute .. Пользователи . Демо . Деньги . Фильмы . Форум . The American Film Institute Salute to Martin Scorsese . США 1997 . отметить . Документальный .

Еще в разделе: (Показать все результаты (>85) - kinfo.ru/ )

• Institute Benjamenta, or Thi.. - Фильмы - Kinfo.ru
• Computer Boy - Фильмы - Kinfo.ru
• Final Fantasy Tactics Advance - Фильмы - Kinfo.ru

... E. Anderson, Z. Bai, C. Bischof, J. Demmel, J. Dongarra, J. Du Croz, A. Greenbaum, S. Hammarling, A. Mckenney, S. Ostrouchov, and D. Sorensen, LAPACK Users' Guide, Society for Industrial and Applied Mathematics, Philadelphia, PA, second ed., 1995. ... E. Anderson, Z. Bai, C. Bischof, J. Demmel, J. Dongarra, J. Du Croz, A. Greenbaum, S. Hammarling, A. Mckenney, and D. Sorensen, LAPACK: A portable linear algebra library for high - performance computers, Computer Science Dept. ...

Еще в разделе: (Показать все результаты (>200) - num-anal.srcc.msu.ru/ )

• Ресурсы Интернет по численному анализу
• Аннотированный перечень сокращений

The Ecological Cooperation Project is the first large-scale children's network project in Russia. This project was founded on the principles of development and achievement of widespread nature awareness among Russian school children through the establishment and unification of numerous childrenтАЩs ecological projects. ... Nature Protected Areas . ... The Project is open for cooperative learning, and any childrenтАЩs ecological organization or group is welcome to participate. ...

Еще в разделе: (Показать все результаты (>19) - www.ecocoop.ru/ )

Joint Design of Micrometeoroid/Orbital Debris Impact Shield and Development of Failure Risk Assessment System for Orbital Spacecraft Nikolay G. Chechenin1, Peijie Li 1 2 Skobeltsyn Institute of Nuclear Physics Lomonosov Moscow State University 2Tsinghua University Space Debris Growth http://www.nasa.gov/pdf/582393main_OCT-Orbital_Debris_TAGGED.pdf January 26, 2016 2nd China-Russia Joint Space Science Project Proposals ...

Еще в разделе: (Показать все результаты (>110) - danp.sinp.msu.ru/ )

• ?????????? ??????????? ?????????

... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... T he goal of this Master Degree program is to educate specialists with the knowledge of the newest technologies of geological study, modeling and development of deposits, advanced scientific methods of seismic and geophysical exploration, geophysical well-logging, production enhancement, etc. ...

Еще в разделе: (Показать все результаты (>3) - www.hsib.msu.ru/ )

Вы посетили: conf_engl.html . ... International Algebraic Conference dedicated to 70th birthday of professor A.V. Mikhalev, Russia, Moscow, November 2010 . ... International Algebraic Conference dedicated to the 100-year anniversary of professor A.G. Kurosh, Russia, Moscow, May 2008 . ... 2nd International Conferences on Matrix Methods and Operator Equations, Russia, Moscow, July 2007 . ... staff/guterman/conf_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>25) - halgebra.math.msu.su/ )

• staff:guterman:activ_rus.html | Кафедра высшей алгебры
• staff:guterman:conf_rus.html | Кафедра высшей алгебры
• staff:arzhantsev_publications | Кафедра высшей алгебры

Irena Lasiecka ( University of Virginia ) . Nikolai Melnikov (CEMI / MSU) . Mikhail Zelikin (MSU / Steklov Institute) . G. Avalos ( University of Nebraska , USA ) . V. Borisov (MSU, Moscow) . ... O. Emanouvilov ( Colorado State University , USA ) . A. Fursikov (MSU, Moscow) S. Hansen ( Iowa State University , USA ) R. Hildebrand ( Joseph Fourier University , France) V. Komornik ( University of Strassburg, France ) A. Kowalewski ( Institute of Automatics, Poland ) . ... Moscow) . ...

Еще в разделе: (Показать все результаты (>4) - oc.cs.msu.su/ )

International Laser Center of MSU . ... Scientific Laboratories . Science . ... 15:00 S.A. Akhmanov Hall, Nonlinear Optics Bld. ... Home Science and education Scientific Laboratories Laboratory of computer simulations in optics . ... Dergachev Aleksandr Aleksandrovich Ph.D. Dormidonov Aleksandr Evgen'evich Ph.D. Kandidov Valeriy Petrovich Doctor of science . ... Femtosecond Nonlinear Optics of High Power Laser Radiation . Femtosecond TW Laser Pulse Filamentation in Gases and Condensed Media . ...

Еще в разделе: (Показать все результаты (>161) - ilc.phys.msu.ru/ )

• International conference on Advanced Laser Technologies ALT'12
• "Computers and measurements" practical course laboratory
• Семинар кафедры ОФиВП и МЛЦ , 2 ноября 2012

... Исследователи химического факультета МГУ представили проект моделирования молекулярной динамики опасных вирусов . ... Владимир Пентковский, известный разработчик программно-аппаратных архитектур, заслуженный исследователь Intel, обладает большим опытом создания научных коллективов в России, США и Индии. ... 2003 2011 MsuNews.Ru Новости МГУ . ... Экспорт новостей (RSS) ...

Еще в разделе: (Показать все результаты (>104) - www.msunews.ru/ )

• MsuNews.Ru | Новости МГУ | Студенты МГУ им. Ломоносова едут в Лондон на финал
• MsuNews.Ru | Новости МГУ

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

General Information . ... Scientific research . ... For physics faculty . ... Department of General Physics and Magneto-Ordered Matter is one of the largest Chairs of Physical Faculty of Lomonosov Moscow State University with long-standing traditions and a numerous community of high qualification teaching personnel and researchers, performing research in the most actual fields of condensed matter physics and teaching graduates in magnetic and ferroelectric phenomena. ...

Еще в разделе: (Показать все результаты (>23) - ferro.phys.msu.ru/ )

• Department of General Physics and magneto-ordered matter. Physics Faculty of
• Laboratory of Ferroelectricity
• Laboratory of Rare Earth Intermetallics

... Astronomy search engine . ... PhysicsWeb Home Page . ... Sternberg Astronomical Institute . ... Astro Space Center Home Page . ... Landau Institute for Theoretical Physics . ... Astronomy and Space Physics Dept of Kiev University . ... NATIONAL RADIO ASTRONOMY OBSERVATORY Home Page . University of Hawaii - Institute for Astronomy . ... Space Telescope Science Institute Home Page . ... Sky & Telescope: The Essential Magazine of Astronomy . ... Springer LINK - Physics Online Library . ... Home . ...

Еще в разделе: (Показать все результаты (>249) - astro.uni-altai.ru/ )

... Issues of the year 2012 . ... Russia, National Research Belgorod State University; 308015, Belgorod, Pobeda St. 85 . E-mail: Chendev@bsu.edu.ru . ... SOILS AS INDICATORS OF CLIMATIC CHANGES Abstract: . ... Key words: chernozems, climate change, Holocene, forest-steppe, steppe . ... Phone: +7-495-624-7257 . ... LANDSCAPE METRICS FROM THE POINT OF VIEW OF MATHEMATICAL LANDSCAPE MORPHOLOGY Abstract: . ... Permafrost Laboratory, Institute of Environmental Geoscience, Russian Academy of Sciences . ...

Еще в разделе: (Показать все результаты (>402) - www.geogr.msu.ru/ )

• Editorial Board
• CONTENT 4 (6) 2013
• CONTENT 2а(7)а2014

The VLT Survey Telescope: a year after its coming into operation Massimo Capaccioli Department of Physics, University of Naples Federico II National Institute of Astrophysics - VST center at Naples The VLT Survey Telescope (VST) is a 2.6 m wide field optical telescope located at the Cerro Paranal Observatory of ESO in the Chilean Andes. ... The wide field is sampled by OmegaCam, a camera with a mosaic of 32 CCD for a total of 256 Mpixels, provided by the homonymous consortium. ...

Еще в разделе: (Показать все результаты (>307) - master.sai.msu.ru/ )

• Ya.B. Zeldovich All-Moscow Seminar of Astrophysicists
• SAI Space Monitoring Laboratory

SUMMER SCHOOL ON VACCINOLOGY for students 3d edition 7 - 13 July 2011 Antwerp, Belgium Bridge the gaps in your knowledge, skills and communication about immunology and vaccines. Meet European experts and experience a high quality learning environment. Benefit from an intensive student-centred training format. Enjoy an international environment in Antwerp. More InforMatIon University of Antwerp Centre for the Evaluation of Vaccination Vaccine & Infectious Disease Institute

Еще в разделе: (Показать все результаты (>12) - www.fbm.msu.ru/ )

• http://www.fbm.msu.ru/sci/conf/2013/mio/infletter-e.pdf

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Partners . ... All partners . ... The Faculty of Journalism, Lomonosov Moscow State University has a long legacy of academic excellence, and we continue to build on that legacy in ways that prepare students to succeed as media professionals in a rapidly changing world. ... Thank you for your interest in the Faculty of Journalism. ... 1999-2014 Faculty of Journalism, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>66) - www.journ.msu.ru/ )

• National association of mass media researchers (NAMMI) (president - Prof. Elena
• Our Partners :: Department of Journalism, M. V. Lomonosov Moscow State
• Partners :: Department of Journalism, M. V. Lomonosov Moscow State University

... 11:00-11:30 Break 11:30-12:00 Lecture 3 Prof . Heinz Oberhammer , Institute of Physical and Theoretical Chemistry , University of Tubingen, Germany Structures and Conformations of Disilacyclohexanes 12:00-12:30 Lecture 4 Prof . Ingvar Arnason , University of Iceland, Iceland Energetics and Potentional Energy Surfaces of Disilacyclohexanes 12:30-13:00 Lecture 5 Prof . Igor Godunov, Chemistry Department , MSU , ...

Еще в разделе: (Показать все результаты (>15) - ged.chem.msu.ru/ )

• Travel information. 14 European Symposium on Gas Phase Electron Diffraction
• General Information. 14 European Symposium on Gas Phase Electron Diffraction
• Abstract submission. 14 European Symposium on Gas Phase Electron Diffraction