Norwegian Libraries: . ... ARLIS - Kunstbib: Norwegian Art History Bibliography. ... The Norwegian Museum of Architecture . ... Art Museums . ... Henie-Onstad Art Center - Hovikodden: Norway's first Museum of Fine Arts on Internet. The Astrup Fearnley Museum of Modern Art . ... National Museum of American Art . Dallas Museum of Art . ... Electra '96 Henie Onstad Art Center's Project for Electronic Media. ... WWW-Library: History of Art . ... News: rec.fine.arts . ... News: k12.ed.art . ...

Еще в разделе: (Показать все результаты (>375) - www.hist.msu.ru/ )

• The Laboratory of Historical Information Sciences
• Textbooks and teaching aids

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

... Electronic journal Issue 4. 10 september 2004 Bonham G.M., Surin A. IP Videoconferencing in Graduate Professional Education: Collaborative Learning for Public Management Introduction. ... While technology offers a range of opportunities that a standard «chalk and talk» class could never match, questions about the educational value of the new digital media loom large. ... If so, how can technology more effectively promote student-centered learning? ... Collaborative IP Videoconferencing. ...

Еще в разделе: (Показать все результаты (>12) - e-journal.spa.msu.ru/ )

... My field of specialization is Stability Theory, Nonlinear Dynamics, Asymptotic Methods, Mechanics of Solids, System Identification, Optimal Control, Economic Growth. ... A.O. Belyakov and A.P. Seyranian (2012). ... A.O. Belyakov and A.P. Seyranian, . ... A.P. Seyranian and A.O. Belyakov, Swing dynamics. ... A.O. Belyakov, A.P. Seyranian, and A. Luongo, Regular and chaotic dynamics of the swing. 6th EUROMECH Nonlinear Dynamics Conference (ENOC 2008) , Saint Petersburg, Russia, June, 30 - July, 4 2008...

Еще в разделе: (Показать все результаты (>6) - belyakov.imec.msu.ru/ )

General Information . ... Scientific research . ... For physics faculty . ... Department of General Physics and Magneto-Ordered Matter is one of the largest Chairs of Physical Faculty of Lomonosov Moscow State University with long-standing traditions and a numerous community of high qualification teaching personnel and researchers, performing research in the most actual fields of condensed matter physics and teaching graduates in magnetic and ferroelectric phenomena. ...

Еще в разделе: (Показать все результаты (>27) - ferro.phys.msu.ru/ )

... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...

Еще в разделе: (Показать все результаты (>16) - observ.pereplet.ru/ )

... Measurement of the MASS detectors parameters with mass program January 24, 2015 [112707] . MASS/DIMM electronics. ... Turbina-core(D): Dimm User Guide. ... N.Shatsky, V.Kornilov, The revision of the MASS/DIMM star catalogue. ... О.Возякова, В.Корнилов, Н.Шатский, Новое программное обеспечение прибора MASS/DIMM. ... V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site. ...

Еще в разделе: (Показать все результаты (>22) - curl.sai.msu.ru/ )

• atmos 3.0 page

... О кафедре . ... Научная работа . ... Главная Научная работа Математические модели взаимодействия элементарных и структурированных объектов . ... Ведущий научный сотрудник Эльтеков В.А. В разное время в состав группы входили: Н.Н.Шапошников, А.В.Овсянкин, В.Б.Шикалов, Н.Г.Васичкина (кафедра математики), Л.П.Развина, О.В.Попова, Н.Н.Негребецкая (кафедра физической электроники), В.Н.Самойлов, Н.Г.Ананьева (кафедра общей физики). ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>13) - matematika.phys.msu.ru/ )

• Кафедра математики Физического Факультета МГУ им. М.В. Ломоносова | Наши

... The Department of Operations Research . ... Coordinators Contacts . ... on Operations Research, . ... Moscow, April 10-14, 2007 Coordinators . ... 1) New models and methods . Prof. V.V. Morozov . ... 3) Multiple objective decision making . ... Prof. I.G. Pospelov, Prof. A.A. Shananin . ... Prof. A.A. Belolipetckiy . ... 9) Game-theoretic models . ... Symposium A: Analysis of the markets and decision making in electric power industry . ... Symposium B: Models of political decision making. ...

Еще в разделе: (Показать все результаты (>12) - io.cs.msu.ru/ )

• Traditional topics of the conference - ORM 2007
• Welcome - ORM 2007
• Program committee - ORM 2007

Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...

Еще в разделе: (Показать все результаты (>7) - lvk.cs.msu.su/ )

О факультете . ... Социологические школы и олимпиады . ... Вестник МГУ . ... МГУ, д. 1. стр. ... English version . ... Programs for foreign students . ... Contacts Faculty of Sociology was founded on June 6, 1989. ... Hence the faculty offers the best educational programs to meet the needs of international students and requirements of contemporary sociology and employment standards in today?s dynamic and changing world. ... PhD programs The faculty provides studies for bachelor's degree in Sociology. ...

Еще в разделе: (Показать все результаты (>89) - www.socio.msu.ru/ )

• Вестник МГУ

Вход в личный кабинет . ... Информационный портал о карьере и работе для студентов и выпускников технических и естественнонаучных специальностей . ... Ярмарка вакансий и стажировок для студентов и выпускников вузов . Новости науки и техники События . ... Вакансии . ... Ярмарки вакансий и выставки . ... Личный кабинет . ... Ярмарка вакансий "Формула карьеры" . ... Если вы хотите регулярно получать информацию о новых вакансиях, наших мероприятиях и новостях сайта, оставьте, пожалуйста, свой адрес. ...

Еще в разделе: (Показать все результаты (>119) - www.physcareer.ru/ )

• Research Scientist / Вакансии / Physcareer.ru
• PhD Position available / Вакансии / Physcareer.ru
• Гранты для обучения в Великобритании (Chancellor's International Research

... Nonlinear fiber optics . ... member of the Editorial Board for the Laser Physics journal . ... Member of the steering committee of the international conference on Raman spectroscopy (ICORS): Budapest, 2002; Brisbane, 2004; Yokohama, 2006; London, 2008 . Member of the steering committee of the International Laser Physics workshop: Bratislava, 2002; Hamburg, 2003; Trieste, 2004; Kyoto, 2005; Lausanne, 2006; Leon, 2007; Trondheim, 2008; Barcelona, 2009 . ... International conference ?Laser Optics? ...

Еще в разделе: (Показать все результаты (>46) - photonicslab.phys.msu.ru/ )

• Research

... Terrestrial ecosystems . Research . ... Environmental pollution and protection in the Norwegian-Russian border area are the main themes of research cooperation between the Soil Science Faculty of Moscow State University (MSU) and the Norwegian Forest Research Institute (NISK). ... The bilateral scientific cooperation between Norway and Russia was established in 1988, based on joint governmental agreement on environmental problems. ... Norwegian Forest Research Institute, Norway . ...

Еще в разделе: (Показать все результаты (>20) - eco.soil.msu.ru/ )

• Forest ecosystem data in Norwegian-Russian border area
• TRANSFORMATION AND STABILITY OF SOILS IN FOREST ECOSYSTEMS UNDER IMPACT OF
• THEORETICAL BASES AND EXPERIMENTAL ANALYSIS OF SOIL SOLUTION TRANSFORMATION

... 104 - 107, 2006 © Kola Science Centre, Russian Academy of Science, 2006 Polar Geophysical Institute STUDY OF THE SOLAR PROTON BELTS IN THE INNER MAGNETOSPHERE L.L. Lazutin, and S.N. Kuznetsov (Space Science Division, Skobeltsyn Institute of Nuclear Physics, Moscow State University, Russia) Abstract. In addition to the stable inner proton belt, enhanced flux of the 1-15 MeV protons has been registered from time to time at L=2.5-3.5 after strong magnetic storms. ...

Еще в разделе: (Показать все результаты (>122) - www.kosmofizika.ru/ )

• Science Technology: Ongoing Solar Activity
• Menu Bar
• CREATION AND DESTRUCTION OF THE SOLAR PROTON BELTS IN THE INNER MAGNETOSPHERE

... Кафедры . ... Krasnoslobodtsev V. P. Territorial availability of higher education in the Northern Caucasus. ... The Northern Caucasus with its relatively favorable demographic structure of population as compared to the rest of Russia is experiencing the profound growth in the availability of higher education. ... In 2007 90% of population of the Northern Caucasus lived within daily distance from higher schools providing mass and prestigious higher education (in law and economics, for example). ...

Еще в разделе: (Показать все результаты (>560) - www.geogr.msu.ru/ )

• Instructions for Authors, contributing to “GEOGRAPHY, ENVIRONMENT,
• FRUGEO GEOGRAPHY RESEARCH INITIATIVE
• CONTENTS ? 2 - 2012

... Руководитель семинара профессор Ю. С. Владимиров . Семинар Российского гравитационного общества , посвященный обсуждению актуальных проблем теории гравитации, а также проблем соотношения геометрии и физики. Первоначальное название семинара: 'Гравитация и микромир' (орган кафедры теоретической физики физического факультета МГУ и секции гравитации НТС министерства ВиССО СССР). ... Официальным научным руководителем большого семинара считался председатель секции гравитации профессор А. А. Соколов. ...

Еще в разделе: (Показать все результаты (>3) - theorphys.phys.msu.ru/ )

• Междисциплинарный семинар 'Метафизика'

. РЕЙТИНГ СЛУХОВ . о проекте права пишите нам .

Еще в разделе: (Показать все результаты (>10) - www.niiss.ru/ )

A.Nekipelov Modernization of Basic Research in Russia: Russian Academy of Sciences ( RAS ) Vision Joint Session of Russian Academy of Sciences, Institute of France Academy of Sciences and Academy of Technology of France Paris, 2010, September 28 1 RAS in Russian Basic Science Potential (per cent, 2008) Russian Federation Research Organizations 100,0 RAS 12,7 Overall Personnel ... Who is the main actor in research: an institute or a laboratory? ...

Еще в разделе: (Показать все результаты (>25) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/sc_pub/fantazzini_sc_pub_2011_en.pdf

The Ecological Cooperation Project is the first large-scale children's network project in Russia. This project was founded on the principles of development and achievement of widespread nature awareness among Russian school children through the establishment and unification of numerous childrenтАЩs ecological projects. ... Nature Protected Areas . ... The Project is open for cooperative learning, and any childrenтАЩs ecological organization or group is welcome to participate. ...

Еще в разделе: (Показать все результаты (>17) - www.ecocoop.ru/ )