... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Partners . ... All partners . ... 16.02.2015 On March 6, 2015 at 12.20 (room 233) Professor Nico Carpentier (Free University of Brussels, Belgium) will deliver a public talk How to research participatory processes? ... Nico Carpentier is Associate Professor at the Communication Studies Department of the Vrije Universiteit Brussel (VUB - Free University of Brussels) and Docent at Charles University in Prague. ...
... Древнеиндийские языки, их диалектная основ. ... Классификация согласных древнеиндийскими учеными по способу и по месту образования. ... Система спряжения глаголов в будущем времени: простое и описательное будущее время; образование основ будущего времени и форм простого будущего времени. ... Имена вторичного образования - присоединение суффикса к основам имен первичного образования. ... Образование от основ имен существительных 1) патронимических и матронимических имен; 2) имен прилагательных. ...
... Baybakov S.E., Bahareva N.S., Chuprunova N.S. Key questions of human physique theory (p. 31-41) During mathematical analysis of the height (H, m), mass (M, kg) and wrist circumference (C, dm) in 154 girls and 58 young men aged 19 years the fundamental dependence of expected body mass (Me) on its length, describing all normally built people, have been established (Me=kH3, where «k» was 12.68 conv. u for girls and 12.17 conv. u for young men). ... The analysis was conducted at two hierarchical levels....
[
Текст
]
Ссылки http://www.antropos.msu.ru/vestnic/e2014_4.doc -- 62.5 Кб -- 23.07.2015
[
Текст
]
Ссылки http://www.anthropos.msu.ru/vestnic/e2014_4.doc -- 62.5 Кб -- 23.07.2015 Похожие документы
... Отмеченная наградами АстроТоп-а . ... Анатолий Анатольевич Волчков . ... кто-то из великих) Я долго подбирал название для этой мемориальной статьи об Анатолии Анатольевиче Волчкове. ... Какие только названия не приходили ко мне в голову - "Легенда об Анатолии", "Исполнить миссию", "Человеко-форум", "Камертон Астрорунета".. ... P.P.S. 31 декабря 2003 г. решением команды проекта Астротоп принято решение - "признать Анатолия Волчкова Человеком года " в традиционных конкурсах Звезды АстроРунета-2003 . ...
... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...
... Globus ToolkitTM Developer Tutorial : Data 7 March 25, 2002 GASS RSL Extensions l executable, stdin, stdout, stderr can be local files or URLs executable and stdin loaded into local cache before job begins (on front-end node) stdout, stderr handled via GASS append mode Cache cleaned after job completes l l l March 25, 2002 Globus ToolkitTM Developer Tutorial : Data 8 ... March 25, 2002 Globus ToolkitTM Developer Tutorial: Data 53 Making GridFTP Go.. ...
[
Текст
]
Ссылки http://acat02.sinp.msu.ru/presentations/GGtut/Dev-07-DataManagement1.pdf -- 743.1 Кб -- 06.07.2002 Похожие документы
... The data on UV glow of the atmosphere obtained in operation of one pixel of the TUS detector on board the Moscow State University "Universitetsky-Tatiana" satellite was taken into account in design of the updated TUS detector. ... The main feature of the design is use of MEMS technology scanning mirror controlled by the TUS computer, analyzing the recorded EAS data and directing the laser to the atmosphere spot, where back scattered Cherenkov light came from. ... Monitoring of UV intensity on-route....
[
Текст
]
Ссылки http://cosrad.sinp.msu.ru/experiments/tus/doc/HO2COSPAR2006.pdf -- 237.2 Кб -- 19.03.2008 Похожие документы
... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...
Особенности загрязнения земель предприятиями нефтегазодобывающего комплекса Нижневартовского района . Features of land pollution by enterprises of oil-and-gas production complex in Nizhnevartovsk region. Ходжаева Г.К. // Нефтегазовое дело, 2011. ... В данной статье приводится зонирование территории Нижневартовского региона по площади и объему нефтяного загрязнения после аварий. URL: http://www.ogbus.ru/authors/Khodzhaeva/Khodzhaeva_1.pdf . ...
Composition of an Efficient Portfolio in the Bielecki and Pliska Market Model / Kambarbaeva G.S. // Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...
Координатор семинара : академик РАН и Academia Europaea Алексей Ремович Хохлов . ... Заседания семинара проводятся в Конференц-зале Института элементоорганических соединений им. А.Н. Несмеянова РАН ( ИНЭОС РАН , г. Москва, ул. Вавилова, 28). ... Скачать объявление о семинаре . ... Б.М. Графов (Интститут физической химии и электрохимии имени А.Н. Фрумкина РАН, Москва) . ... После доклада предполагается обсуждение целесообразности организации Общемосковского семинара по электрохимии. ...
NMW survey overview . Access image archive . ... The New Milky Way survey aims to detect bright (V<13.5) optical transients near the Galactic plane using an automated wide-field (8x6 deg.) system capable of surveying the whole Milky Way area visible from the observing site in one night. ... All images obtained during the transient search survey are available online (please use the image archive access form ). ... Images per field: . ... Images per night: . ... Milky Way imaging time: . ...
... Linguistic expeditions . ... Logical and stylistic aspects of lexical semantics . ... Linguistic phenomena can be approached and described from various perspectives. ... The approach proposed here is distinctive in that it is based on logic and stylistics, which are usually considered marginal to the description of linguistic phenomena. ... A special focus in the present approach on parallel texts is directly connected with translation . ...
Optical imaging of fluorescent carbon biomarkers using artificial neural networks Tatiana A. Dolenko Sergey A. Burikov Alexey M. Vervald Igor I. Vlasov Sergey A. Dolenko Kirill A. Laptinskiy Jessica M. Rosenholm Olga A. Shenderova Downloaded From: http://biomedicaloptics.spiedigitallibrary.org/ on 12/17/ 2014 Terms of Use: http://spiedl.org/terms Journal of Biomedical Optics 19(11), 117007 (November 2014 ) Optical imaging of fluorescent ... Results of Using Artificial Neural Networks Fig. ...
[
Текст
]
Ссылки http://rswater.phys.msu.ru/en/articles/2014/JBO_19_11_117007.pdf -- 801.2 Кб -- 17.12.2014 Похожие документы
. If you see this page, the nginx web server is successfully installed and working. Further configuration is required. For online documentation and support please refer to nginx.org . Commercial support is available at nginx.com . Thank you for using nginx.
... How to Spot Counterfeit Tommy Hilfiger . ... the north face outlet uk . ... win 7 ultimate product key Windows 8 key windows 7 key win 7 key windows 7 pro product key win 7 pro product key windows 7 activation key windows 7 ultimate product key windows 7 ultimate serial key windows 7 key online win 7 ultimate key win 7 serial keys Win 7 ultimate key Win 7 ultimate product key windows 7 key sale win 7 ultimate product Key Windows 7 key ultimate win 7 ultimate ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы