... Hyper-Rayleigh scattering in nongomogeneous thin films and interfaces . ... N.V. Didenko , B.P. Antonyuk, N.N. Novikova, and O.A. Aktsipetrov , Light-induced c -nonlinear susceptibility and its 1/ w fluctuations in silica glasses, Phys. Lett. ... N.V. Didenko , A.A. Fedyanin, E.P. Lukashev, and O.A. Aktsipetrov, Nonlinear interferometry of second-harmonic generation and hyper-rayleigh scattering from thin inhomogeneous films, IQEC ’98 [San Francisco, USA, 1998, Technical Digest, p. 111-112]. ...
SPAW Editor PHP Edition version 1.0.6 Release Notes Thanks to everyone who downloaded, tried and supported SPAW Editor! This release includes several new features: css classes for tables, background images in tables and table cells, improved link dialog and more. ... If you are fluent in any of languages that are now included and see any typos or mistakes please report to spaw@solmetra.com Happy editing, Alan Mendelevich a.k.a. ailon alan@solmetra.com ...
On the problem of the spontaneous exchangedriven electron interwell repopulation in semiconductor quantum wells This article has been downloaded from IOPscience. ... It is easy to show why any N electron singlewell state wave function in our system has this form. ... Discussion The results of the preceding section show that for any given state of our system with all electrons in one well there is another state with the symmetrical electron distribution over wells and a lower energy. ...
with Materials Atoms Nuclear Instruments and Methods in Physics Research B xxx (2005) xxxxxx www.elsevier.com/locate/nimb Cluster size dependence of sputtering yield by cluster ion beam irradiation T. Seki a a,b,* , T. Murase a, J. Matsuo a Quantum Science and Engineering Center, Kyoto University, Gokasyo, Uji ... These results suggested an empirical formula to calculate sputtering yield from the ion energy and the size distribution of the cluster. ... Fig. ...
[
Текст
]
Ссылки http://danp.sinp.msu.ru/Articles_GSIB/nimb_sputteryield_sizeclasterion.pdf -- 138.5 Кб -- 07.10.2005 Похожие документы
Post-Telbessian Strike-Slip-Related Compressional and Extensional Structures in Central Kazakhstan . ... Faults controlled post-telbessian structuring are of Late Devonian - Early Permian age; they are usually deep-seated. ... Thus, post-telbessian structure of Central Kazakhstan has developed under condition of relatively monotonous stress field with sub-longitudal orientation of main compression and latitudal orientation of main extension. ...
TEMPERATURE OF REGOLITH IN COLD TRAPS ON THE MOON A.A. Berezhnoi Sternberg Astronomical Institute Moscow, Russia The hypothesis of the existence of the lunar ice in cold traps was stated in (Watson et al., ... Arnold, 1979) estimated the mean temperature on the surface of lunar cold traps as 40-90 K. We plotted the dependence of regolith mean temperature on depth for these two values of mean temperature on the surface (see figure 1). ... Arnold J.R. Ice in the lunar polar regions, J. Geophys. ...
. Summary of experimental results . The light absorbing capacity of phytoplankton, estimated from Fo , and its photosynthetic activity (estimated as Fv/Fm ) are key characteristics of the primary processes of photosynthesis. We suggested a formula for calculation of the primary production of phytoplankton from these two characteristics and underwater irradiance. The probing data were used to plot vertical profiles of phytoplankton productivity in various regions of the Baltic, Norwegian, and South China
... Cell Biol.. ... After nocodazole treatment (20 µ), the number of microtubules attached to the centrosome decreased by 20% after 10 min of treatment, remained the same after 20 min of treatment, and increased after 60 min of nocodazole treatment slightly above the control level. ... EXPERIMENTAL Cell cultures. ... The result is that in the course of 60-min treatment with nocodazole the number of microtubules attached to the centrosome increases and even becomes 1.5 times as high as their normal level...
[
Текст
]
Ссылки http://cellmotility.genebee.msu.ru/html/articles/alieva97.pdf -- 449.7 Кб -- 08.05.2002 Похожие документы
... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Настоящим выпуском антропологи МГУ объявляют о появлении нового издания 'Вестник Московского университета. Серия ХХIII. Антропология'. ... В продолжение традиций мы надеемся, что 2009 год станет годом обновления Музея антропологии Московского университета, который откроется в Старом здании на Моховой после ремонта и реконструкции. ... Балахонова Е.И. Африканские коллекции из Московского Публичного и Румянцевского музея в Музее антропологии МГУ. ... А.Л. Пурунджан (1947-2009) Открыть . ...
Proceedings of ICHIT- 06 26 February - 5 March 2006, Moscow, Russia DIRECT NUMERICAL SIMULATION OF TURBULENT RAYLEIGH-BENARD CONVECTION IGOR B. PALYMSKIY Modern Academy for Humanities, Novosibirsk Branch , Novosibirsk, Russia, 630064 palymsky@hnet.ru Abstract Turbulent convectional flow of water in horizontal layer with free and rigid horizontal boundaries, arising by heating from below, is numerically simulated by spectral method using the Boussinesq model without ... Present, 2-D, free, | ...
... A comparative study of thermodynamic for both natural and artificial RNA/DNA protein complexes would establish bases for a specificity of complex formation. In particular, we have shown that aptamers could be used for a direct measuring of thrombin enzymatic activity in a solution. D 2002 Published by Elsevier Science B.V. Keywords: RNA/DNA protein interactions; Ribosome; SELEX; RNA/DNA aptamers; Thrombin; Enzymatic activity 1. ... The aptamer binds to the protein with Kd = 0.5 nM. ...
[
Текст
]
Ссылки http://rnp-group.genebee.msu.su/pdfs/article_vas_bioelectro.pdf -- 140.7 Кб -- 21.10.2002
[
Текст
]
Ссылки http://rnp-group.genebee.msu.ru/pages/pdf/bioelectro2002.pdf -- 140.7 Кб -- 18.02.2008 Похожие документы
ДД PROCEEDINGS OF THE 31st ICRC, LODZ 2009 1 Preliminary Proton and Helium Spectra from the CREAM-III Flight Y. S. Yoon , H. S. Ahn , T. Anderson, L. Barbier?, ... Keywords: CREAM; energy spectra; protons and helium nuclei I . ... CREAM-III I N S T RU M E N T A N D F LIGHT The CREAM-III instrument consisted of a tungsten/scintillating fiber calorimeter, a dual layer Silicon Charge Detector (SCD), a Cherenkov Camera (CherCam), a Cherenkov Detector, and a Timing Charge Detector (TCD). ...
) REGUL ATION (EC) No 1906/2006 OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL of 18 December 2006 laying down the rules for the par ticipation of under takings, research centres and universities in actions under the Seventh Framework Programme and for the dissemination ... relevance) THE EUROPEAN PARLIAMENT AND THE COUNCIL OF THE EUROPEAN UNION, (3) Having regard to the Treaty establishing the European Community , and in particular ... Article 48 Article 50 Principles Access rights for use 1. ...
Problems for Ultrahyperbolic Equations in Half-Space Prof. Dmitry P. Kostomarov Faculty of Computational Mathematics and Cybernetics Lomonosov Moscow State University Pontryagin Anniversary Conference June 1722, 2008 , Moscow, Russia Section Differential Equations Subsection Partial Differential Equations Prof. D.P. Kostomarov (CMC MSU) Problems for Ultrahyperbolic Equations June 22, ... June 22, 2008 (2.13) Problems for Ultrahyperbolic Equations 16 / 23 2.2. ...
[
Текст
]
Ссылки http://ani.cs.msu.su/files/kostomarov-pontryagin2008.pdf -- 414.5 Кб -- 22.06.2008
[
Текст
]
Ссылки http://ani.cmc.msu.ru/files/kostomarov-pontryagin2008.pdf -- 414.5 Кб -- 22.06.2008 Похожие документы
Embedding formulae for Laplace-Beltrami problems on the sphere with a cut. ... Introduction We are considering the scalar problem of plane wave diffraction by a quarter-plane. ... Applying the BesselSommerfeld technique he has obtained the following formula for the diffraction co efficient: ^ i f ( , 0 ) = e-i g ( , 0, ) d, (1 ) where 0 and are directions of incidence and scattering, is the separation parameter and g is the Green's function of the of the spherical problem. ...
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/emb_sphere.pdf -- 178.7 Кб -- 25.11.2011
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/shanin_files/~shanin/papers/emb_sphere.pdf -- 178.7 Кб -- 25.11.2011 Похожие документы