... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
This page is devoted to information on Supernova 1999bg in IC 758 . ... Information on the original web pages for many of these images can be found on the Supernova links web page. 1999bg is another discover by the Lick Observatory Supernova Search who have been very prolific over the past year but have had a bit of a lull lately. ... AUDE has a 1999bg page in French [ Translate ] . M1 Supernova search has a 1999bg page in Spanish [ Translate ] . Seiichi Yoshida has a 1999bg images page . ...
... 4, 1998 Blue Light Inhibits Mitosis in Tissue Culture Cells L. A. Gorgidze,1 S. A. Oshemkova,1 and I. A. Vorobjev1'2 Received June 17, 1998 Irradiation of the mitotic (prophase and prometaphase) tissue culture PK (pig kidney embryo) cells using mercury arc lamp and band-pass filters postponed or inhibited anaphase onset. ... PK Cells Response to the Blue-light Irradiation The first question to be answered was whether irradiation of a whole cell with visible light inhibits mitotic progression. ...
[
Текст
]
Ссылки http://cellmotility.genebee.msu.ru/html/articles/gorgidze98.pdf -- 1449.4 Кб -- 13.05.2002 Похожие документы
THE ROLE OF DEVELOPING NATION TOWARDS COMBATING THE CYBER CRIME Abhishek Vaish and Satya Prakash, Indian Institute of Information Technology, Allahabad. ... Highlights on the recent trends: A report of Indian computer Emergency Response Team (CERTIN) shows that more than 2500 incidents were registered and handled in the year 2008. ... Others security incidents reported in the year 2004 was 4, in the year 2005 was 18, in the year 2006 was 17, in the year 2007 was 264 and in the year 2008 was 94. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/bayern2010/vaish_ea.pdf -- 652.4 Кб -- 02.04.2012 Похожие документы
... Introduction The purpose of this paper is to define the meaning of the Bronze Age Luvian lexeme 416-wa / i-nМ -.1 It occurs several times in the inscriptions YALBURT and SэDBURG , which contain the res gestae of the two Hittite kings of the late Empire period, Tuthaliya IV and Suppiluliyama II, and once in the inscription KIZILDA' 4, which commemorates the deeds of a certain Hartapu, possibly a king of Tarhuntassa.2 The frequency of this word in the Bronze Age ... The Luvian Enemy 19 1997...
[
Текст
]
Ссылки http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/ENEMY.pdf -- 468.1 Кб -- 30.04.2010
[
Текст
]
Ссылки http://imk.msu.ru/Structure/Linguistics/yakubovich/download/ENEMY.pdf -- 468.1 Кб -- 30.04.2010 Похожие документы
... RUBRRRIKA RUBRIKA Dynamics of Atoms Interacting Via the Radiation Field in an Optical Dipole Trap D. N. Yanyshev1, *, B. A. Grishanin1, V. N. Zadkov1, and D. Meschede2 1 International Laser Center and Faculty of Physics, Moscow State University, Moscow, 119899 Russia 2 Institute of Applied Physics, University of Bonn ... By varying both the optical dipole trap parameters and intensity of the probe laser field, the role of RDDI in the atomic dynamics in the trap is clarified in detail. ...
SCALE-SPACE METHOD OF IMAGE RINGING ESTIMATION Andrey V. Nasonov, Andrey S. Krylov Lab. of Mathematical Methods of Image Processing, Faculty of Comp. ... Ringing effect (Gibbs phenomenon) appears in images as oscillations near sharp edges. ... One of the main problems of image deringing is to detect the presence of ringing effect and to estimate the necessary ringing suppression level. ... T V values of edges with ringing artifacts are greater than T V values of edges without ringing effect. ...
[
Текст
]
Ссылки http://imaging.cs.msu.ru/pub/2009.ICIP.Nasonov_Krylov.RinMetr.en.pdf -- 225.3 Кб -- 06.08.2009
[
Текст
]
Ссылки http://imaging.cs.msu.su/pub/2009.ICIP.Nasonov_Krylov.RinMetr.en.pdf -- 225.3 Кб -- 06.08.2009
[
Текст
]
Ссылки http://imaging.cmc.msu.ru/pub/2009.ICIP.Nasonov_Krylov.RinMetr.en.pdf -- 225.3 Кб -- 06.08.2009 Похожие документы
STARTINCLUDE% ---+ Access Control _Restricting read and write access to topics and webs, by users and groups_ Access Control allows you restrict access to single topics and entire webs, by individual user and by user Groups. ... For example, for the <nop>KasabianGroup topic write: * ==Set <nop>ALLOWTOPICCHANGE = %USERSWEB%.<nop>KasabianGroup== * *Caution* This is set in the "Topic Settings" and not inline in the topic text! <blockquote class="foswikiHelp"> %X% Foswiki has strict formatting rules. ...
... Начало www.99ru.ru Религия и эзотерика Христианство 1314 . ... История.Философия . ... Застольные беседы (речи) Мартина Лютера 1566г репринт оригинала Luthers Tischreden Немецкий Готический шрифт . ... Martin Luther died on the 18th of February, 1546, and the first publication of his "Table Talk"-Tischreden-by his friend, Johann Goldschmid (Aurifaber), was in 1566, in a substantial folio. ... He began his studies at the University of Wittenberg in 1537, where he attached himself closely to Luther. ...
Experimentation and Personality , 1 Explicating the Black Box through Experimentation : Studies of Individual Differences and Cognitive Processes Howard Lavine Department of Political Science, SUNY Stony Brook Stony Brook, NY 11794-4392 Howard.Lavine@sunysb.edu Corresponding Author Milton Lodge Department of Political Science, SUNY Stony Brook Stony Brook, NY 11794-4392 Milton.Lodge@sunysb.edu James Polichak School of Law, University of Michigan ... The Authoritarian Personality. ...
[
Текст
]
Ссылки http://www.suny.msu.ru/ru/Lavine's%20article.pdf -- 94.0 Кб -- 24.08.2010
[
Текст
]
Ссылки http://suny.msu.ru/ru/Lavine's%20article.pdf -- 94.0 Кб -- 24.08.2010 Похожие документы
... DEVELOPMENT OF EXPLICIT CYCLIC SCHEMES . WITH CHEBYSHEV?S POLYNOMIALS FOR SPACE NEUTRON KINETICS . ... Questions have been studied to use effectively explicit schemes for solving spatial kinetics. ... Algorithms have been developed to solve spatial kinetic equations on the basis of explicit cyclic schemes with time varying steps designed by V.I. Lebedev [1] as well as schemes of local iterations proposed by O.V. Lokutsievskiy and V.O. Lokutsievskiy [2]. ... Code development. ...
... Русский язык как иностранный . ... Философия грамматики. Предисловие . ... Известный датский языковед Отто Есперсен (1860-1943) по-святил целый ряд трудов вопросам общего языкознания ('Язык', 'Система грамматики ', 'Учебник фонетики'), вопросам истории и теории английского языка ('Прогресс в языке, в специальном при-менении к английскому языку', 'Рост и строй английского языка ', 'Грамматика современного английского языка на исторической ос-нове [в 7 томах]', 'Основы английской ...
... 2009 . ... The International Conference on Coherent and Nonlinear Optics (ICONO) and The Lasers, Applications, and Technologies (LAT) ICONO/LAT, 18-22 June 2013, Moscow, Russia (800 участников) . ... 15th International Conference on Laser Optics ?LO-2012?, ... Amitonova L.V., Lanin A.A., Fedotov I.V., Ivashkina O.I., Zots M.A., Fedotov A.B., Anokhin K.V., Zheltikov A.M. ?Fiber-based platform interfaces for functional studies in neurophotonic? 15th International Conference on Laser Optics ?LO-2012?. ...
... Rolling of a Homogeneous Ball over a Dynamically Asymmetric Sphere Alexey V. Borisov* , Alexander A. Kilin** , and Ivan S. Mamaev* Institute of Computer Science, Udmurt State University ul. Universitetskaya 1, Izhevsk 426034, Russia Received Novemb er 11, 2010; accepted Decemb er 6, 2010 ** Abstract--We consider a novel mechanical system consisting of two spherical bodies rolling over each other, which is a natural extension of the famous Chaplygin problem of rolling motion of a ball on a plane. ...
[
Текст
]
Ссылки http://ics.org.ru/upload/iblock/10f/171-rolling-of-a-homogeneous-ball-over-a-dynamically-asymmetric-sphere_ru.pdf -- 644.2 Кб -- 28.10.2015 Похожие документы
... Добавления на страницу Языки программирования , изменение структуры. 7 мая 2010 года Xilinx выпускает программное обеспечение ISE Design Suite 12. 20 апреля 2010 года Altera выпускает семейство FPGA Stratix V, разработанных по 28-нанометровой технологии. 9 апреля 2010 года В University of Regensburg будет установлен суперкомпьютер QPACE с пиковой производительностью 56 TFlop/s; коммуникационная сеть ... Altera выпускает новые варианты FPGA семейства Stratix IV. 20 мая 2009 года . ...
... Научные исследований . ... Дмитриев Владимир Иванович : Доктор физико-математических наук, профессор кафедры математической физики, . ... Научные работы : В.И. Дмитриев опубликовал более 400 научных работ, в том числе 22 монографии и учебных пособия. ... Барашков Игорь Сергеевич Кандидат физико-математических наук, старший научный сотрудник. ... Область научных интересов: математическое моделирование сложных физических явлений (плазмофизика, физика твердого тела, геофизика, физика атмосферы). ...
... Информация о Службе . ... Служба содействия трудоустройству ставит перед собой задачу информирования студентов и выпускников о карьерных возможностях в компаниях, заинтересованных в специалистах, получивших образование на нашем факультете, и приглашает к сотрудничеству работодателей. ... Организатор: Служба Содействия Трудоустройству при Экономическом факультете МГУ им. М.В. Ломоносова . ... Чемпионат пройдет 17 апреля 2016 года на Экономическом факультете МГУ им М.В. Ломоносова. ... Опыт работы: . ...
VARIABLE STARS, THE GALACTIC HALO AND GALAXY FORMATION C. Sterken, N. Samus and L. Szabados (Eds.) 2010 Formation Mechanisms for Spheroidal Stellar Systems O. K. Sil'chenko 1 Sternberg Astronomical Institute of the Moscow State University, Moscow, Russia Abstract. Spheroidal stellar systems on various scales include elliptical galaxies, dwarf spheroidal galaxies, and globular stellar clusters. ... The formation mechanisms of the oldest globular clusters represent a puzzle yet. ... 2009). ...
... 78, 2000 UDC 620.18:65.012.12.001/002 REPRODUCIBILITY OF THE STRUCTURE AND PROPERTIES OF PARTS AND THEIR DESCRIPTION WITHIN THE FRAMEWORK OF NONLINEAR DYNAMICS A. Yu. ... The problem of the reproducibility of complex structures is discussed from the standpoint of the applied theory of dynamic systems. ... The problem of the reproducibility of complex structures that appear in nonlinear media has become closely connected with some problems of the applied theory of dynamic systems. ...
DAYS on DIFFRACTION' 2011 77 Analytical solutions for diffraction problem of nonlinear acoustic wave b eam in the stratified atmosphere Vladimir A. Gusev, Ruslan A. Zhostkow Department of Acoustics, Physical Faculty, Lomonosov's Moscow State University, Russia; e-mail: vgusev@bk.ru The nonlinear wave equation and mo dified KhokhlovZab olotskaya typ e equation for high intensive acoustics wave b eams propagating in stratified atmosphere with inhomogeneous of sound sp eed is set up. ...
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/gusev_files/diff2011.pdf -- 68.4 Кб -- 07.11.2012
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/gusev_files/diff2011.pdf -- 68.4 Кб -- 07.11.2012 Похожие документы