... Сотрудники . ... Научная работа . ... Сверхпроводимость вызывает огромный интерес, т.к. передача электрического тока без энергетических потерь сулит огромные перспективы. Актуальность поиска соединений для электрохимической интеркаляции мультивалентных катионов, также как и разработки фундаментальных основ кристаллохимического дизайна таких соединений, связана с возрастающими потребностями в легких высокоэффективных возобновляемых химических источниках тока (ХИТ). МГУ им. М.В. Ломоносова . ...
... Cell Biol, 1997, Vol. 11 (2), pp. ... In the cells polarized at the edge of an experimental wound, cytoplasmic granules moved randomly (Brownian motions) and by separate jumps (saltatory movements). ... In such cells, we observed radial tracks (going from the nucleus to the edge of the lamella) and tangential tracks (when the movement of the granule was tangential to the nucleus). ... In the spread part of the leading edge of a cell, as a rale, not more than two granules (3-4%) proved out of focus. ...
[
Текст
]
Ссылки http://cellmotility.genebee.msu.ru/html/articles/grigoriev97.pdf -- 1506.7 Кб -- 17.05.2002 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Запись в библиотеку . ... Книги . ... История МГУ: библиография . ... В каталоге отражены отечественные газеты с 2013 года по настоящее время, хранящиеся в отделах Научной библиотеки. ... Картотека включает описания материалов (с 2005 г.) по истории МГУ имени М.В. Ломоносова. ... Научная библиотека МГУ имени М.В. Ломоносова (НБ МГУ) - обособленное подразделение в структуре университета, действует на основании Положения о библиотеке . ... 2016 Научная библиотека МГУ имени М.В. Ломоносова (НБ МГУ)ї . ...
Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . ... Электронные ресурсы . ... Ресурсы МГУ . ... Сайт Библиотеки МГУ . ... Напоминаем Вам, что каждый, кто пользуется доступом к журналам в электронном виде, как из помещений библиотеки, так и со всех компьютеров физического факультета не может прямо или косвенно использовать просматриваемые и сохраняемые материалы для: . ... Тематика журналов: Humanities, Law, Life Sciences, Mathematics Sciences, Medicine, Social Sciences. ...
A full system of equilibrium differential equations for the finite number of suspension lines (n = 28) of square parachute is derived. ... One can determine the shapes of inflated canopy radial cross-sections, stress distribution of radial ribbons on the canopy surface and fabric stress between them, drag coefficients for various line lengths and air-permeability by means of computer simulation. ... Initially, this problem was solved assuming D p = const over total canopy of square parachute. ...
... Tatiana Venediktova . American Way of Speech" as a Fictional Model, M. Bakhtin as a Transatlantic Traveller . ... Т.Д. Венедиктова, М. Б. Раренко . ... С коллегами на конференции . Predecessors: Intellectual Lineages in American Studies", September 1999 - Amsterdam, Netherlands . ... Rediscovering America: American Studies in the New Millennium", March, 2000 - Hyderabad, India ...
... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...
PHYSICAL REVIEW B VOLUME 54, NUMBER 3 15 JULY 1996-I dc-electric-field-induced second-harmonic generation in Si,,111.. ... Optical second-harmonic generation SHG is a sensitive tool for studying the characteristics of buried solid-electrolyte and solid-solid interfaces, as has been demonstrated in a number of experiments.13 The SHG technique was shown to be extremely sensitive to the structural symmetry,46 and steps and kinks on vicinal surfaces,79 as well ... 8 E 0 scL d / d int 0 . ...
[
Текст
]
Ссылки http://shg.phys.msu.ru/ruscon/articles/pdf/96_PhysRevB_54.pdf -- 167.3 Кб -- 12.03.2008 Похожие документы
... Keywords: anthropology, craniotrigonometry, skull angular morphometry, the Russian Imperial Romanov family, shaping angles parameters Sviridov A.A. Cranial study of population of Loyalty Islands (Melanesia) (p. 88) The aim of this work is to study cranial series of 67 skulls from the Loyalty Islands (Northern Melanesia), stored at Musee de l'Homme (Paris, France). ... The study of intragroup variability showed a difference in the cranial types of the population of the Lifou and Mare islands. ...
[
Текст
]
Ссылки http://www.antropos.msu.ru/vestnic/e2014_2.doc -- 71.0 Кб -- 23.07.2015
[
Текст
]
Ссылки http://www.anthropos.msu.ru/vestnic/e2014_2.doc -- 71.0 Кб -- 23.07.2015 Похожие документы
ISSN 0027-1349, Moscow University Physics Bulletin, 2008, Vol. ... Application of Chaotic Mapping for the Encryption of Information A. Yu. Loskutov and A. A. Churaev Department of the Physics of Polymers and Crystals, Faculty of Physics, Moscow State University, Leninskie gory, Moscow, 119992 Russia e-mail: Loskutov@chaos.phys.msu.ru Received May 30, 2007 Abstract--A new method previously proposed [1] for the encryption of information by means of chaotic mappings is studied in detail. ...
... In the case when the beam diameter exceeds the coherence length of the acoustic wave, the fourth-order correlation function is found to contain an interference structure, whereas the intensity angular distribution has a one-peak shape. ... In the present paper we show how the measurement of the intensity correlation function of light scattered by acoustic waves can provide information that is not contained in the intensity distribution. ... The wave vector of the acoustic wave is denoted by k a . ...
Search of Novel Crystalline Materials , Study of their Properties and Crystallization Processes . ... The work of group for the search of novel crystalline materials are held at M.V. Lomonosov Moscow State University since 1964. The main aim of investigations are search and study of new promising multifunctional materials with unusual physical properties: ferroelectrics, superionic conductors, nonlinear optical materials, laser crystals, piezoelectrics, etc. ...
BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...
... Master Education . ... Master programs . ... objects, development and application of advanced mathematical methods and software to address problems in science, technology, economics and management.The Mathematics and Information Technology for Economic Activity Master ?s programme aims to prepare professionals in economics and finance ... This program aims to prepare high-qualified professionals for the commercial and government organizations in economics and the finance, including: . ...
... The mo del is a directed dyadic acyclic graph. ... New vertexes are added one by one. The probability of this addition dep ends on the structure of existed graph. ... 4 (2 ) FIGURE 4: The probabilities of different variants to add a new vertex to the future in the step number 500. pij is the probability to add a new vertex to the outgoing external edges numbers i and j . Similarly, p is the probability to add a new vertex to the incoming external edges numbers and . ...
[
Текст
]
Ссылки http://temporology.bio.msu.ru/EREPORTS/krugly_an-example.pdf -- 690.9 Кб -- 27.02.2014 Похожие документы
ft ra D DAYS on DIFFRACTION 2012 1 Theory of selfrefraction effect of intensive fo cused acoustical b eams V.A. Gusev Lomonosov's Moscow State University, Physical Faculty, Department of Acoustics, Russia, 119991, Moscow, Leninskie gori; e-mail: vgusev@bk.ru The theory of selfrefraction of nonlinear acoustical beams is developed based on some exact and approximate analytical equations and solutions. ... What is the main factor limiting the pressure in the focus -- diffraction or selfrefraction? ...
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/gusev_files/diff2012.pdf -- 698.1 Кб -- 07.11.2012
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/gusev_files/diff2012.pdf -- 698.1 Кб -- 07.11.2012 Похожие документы
... Antal , T.K., Volgusheva , A.A., Kukarskih , G.P., Krendeleva , T.E., Rubin, A.B. Relationships between H 2 photoproduction and different electron transport pathways in sulfur-deprived Chlamydomonas reinhardtii (2009) International Journal of Hydrogen Energy, 34, pp. ... Antal , T.K., Volgusheva , A.A., Kukarskikh , G.P., Krendeleva , T.E., Tusov , V.B., Rubin, A.B. Examination of chlorophyll fluorescence in sulfur-deprived cells of Chlamydomonas reinhardtii (2006) Biofizika ., 51 (2), pp. ...