... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...
... We have compiled the Catalogue of extragalactic supernovae using the GCVS card catalogue. ... Doubtful (?), or rejected (-) SN 8 A1 --- RemFlag [*] The '*' indicates a remark in sn_rem.dat 10- 19 A10 --- Gal Parent galaxy designation 21- 22 I2 h RAh Right Ascension 1950 of Parent galaxy 23- 24 I2 min RAm Right Ascension 1950 (minutes) 25- 28 F4.1 s RAs Right Ascension 1950 (seconds) 29 A1 --- DE- Declination 1950 (sign) 30- 31 I2 deg DEd Declination 1950 of Parent ...
... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...
... The experimental data obtained using Cherenkov light of EAS reflected from the snow surface of the Big Alma-Ata Lake (Kazakhstan) are presented. ... The balloon-borne measurements in the energy range 10 15 -10 20 eV are planned. ... SPHERE detector array was elaborated for balloon-borne experiment [3-5]. ... SPHERE detector was situated on the 160 m high mountain ledge nearby the B.Alma-Ata lake (2500 m above sea level) to detect Cherenkov light reflected from the snow surface of the lake. ...
... An extended set of observables of the nuclear quasi-free (p, d + ) reaction including the triple differential cross-section for coincidence measurements, its analyzing power in case of polarized proton beams and, also, the parameters of the polarization of the excited recoil nucleus and the produced deuteron are considered in the framework of the distorted-wave impulse approximation using the reaction 16 O(p, d + )15 N at a proton energy of 650 MeV as an example. ...
[
Текст
]
Ссылки http://np-chair.sinp.msu.ru/download/epja100510-offprints.pdf -- 426.2 Кб -- 18.03.2015 Похожие документы
ASPEN CENTER FOR PHYSICS 2009 WINTER CONFERENCE ON ASTRONOMY February 1-7, 2009 THIRTY YEARS OF MAGNETARS: NEW FRONTIERS It has now been almost 30 years since March 5, 1979, when the spectacular giant flare was detected from SGR 0526-66, providing the first obser vational indication of the existence of a magnetar. ... In par ticular, the advent of the latest generation space- and ground-based obser vatories has impacted our knowledge of magnetars and other classes of neutron stars. ...
[
Текст
]
Ссылки http://phys.msu.su/upload/iblock/02c/Astronomy.pdf -- 66.1 Кб -- 13.10.2008
[
Текст
]
Ссылки http://www.phys.msu.ru/upload/iblock/02c/Astronomy.pdf -- 66.1 Кб -- 13.10.2008
[
Текст
]
Ссылки http://phys.msu.ru/upload/iblock/02c/Astronomy.pdf -- 66.1 Кб -- 13.10.2008 Похожие документы
Moscow Times о российских программах Executive MBA . Moscow Times цитирует директора программы Executive MBA ВШБ МГУ Вячеслава Болтрукевича и студента группы ЕМВА11.н Алексея Богатырева в статье Biz School for Executives Entices Students . ... In his estimation, the education that he's receiving in the EMBA program at Moscow State University's Graduate School of Business is about equal to that of Western schools. ... He said he's now ready to lead any project in any sphere of business. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Ярмарка вакансий и стажировок для студентов и выпускников вузов . ... University of Groningen, The Netherlands . PhD Position available . ... PhD Position in Theoretical Chemistry . ... She is considered to be one of top 5 universities in Europe for research in Materials Science, Chemistry, Space Science, Microbiology, and Environment/Ecology. ... In 1993, the MSCplus was accredited by the Royal Netherlands Academy of Arts and Sciences (KNAW) as a leading Research School in Materials Science. ...
... The applied mathematics (with Honors), Kazan State University, Kazan, Russia (USSR), 1980. nd Alexander Lazarev Research Interests Discrete optimization: combinatory problems, modeling, decomposition algorithms, applications to production planning and scheduling. ... Kazan, Publishing house of the Kazan mathematical society, 1998. - 285 p. Lazarev A.A., Gafarov E.R. Scheduling Theory. ... Computer centre of the Russian Academy of Sciences - 2006. - 134 p. Lazarev A.A., Gafarov E.R. Scheduling Theory...
[
Текст
]
Ссылки http://physcontrol.phys.msu.ru/materials/aal/CV_Lazarev_2012.pdf -- 455.1 Кб -- 15.05.2014 Похожие документы
Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete
[
Текст
]
Ссылки http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cs.msu.su/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cmc.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011 Похожие документы
... Most of UNIVERSAT-2009 participants will need a visa when entering the Russian Federation. ... Please take into account that the Organizing Committee needs about two months to provide this Official Invitation Letter and you will need about one month to apply for visa. For those who need the invitation letters confirming their participation in the UNIVERSAT-2009 meeting for other purposes (like funding or booking) the letters of such kind will be easily issued on the request. ...
... Scientific goals . ... Automatic gaze stabilization corrector . Scientific equipment . ... IMISS-1 . ... Comparing the measured and calculated values we?ll find out if it is possible to use microelectromechanical inertial measuring modules in an automatic gaze stabilization corrector , and calculate the value of changes of microsensors? instrumental errors under the space conditions as against the Earth ones. ...
... Carbon and Nitrogen As Resources Limiting the Growth of Mono- and Mixed Cultures of Pseudomonas aeruginosa Dissociants P. V. Fursovaa, E. S. Mil'kob, and A. P. Levichc c Department of Biophysics Department of Microbiology Department of General Ecology, Moscow State University, Moscow, 119991 Russia e-mail: fursova @biophys.msu.ru b a Received December 26, 2006 Abstract--New experiments for detection of resources limiting the ... 1997; Levich, 2000). ... 1) (Levich et al., ...
... Second-year students classes . ... The course offers profound description of popular techniques of parallel programming such as OpenMP and MPI. ... Rapid growth of productivity of the modern computing systems is achieved by using parallel processors and multicore systems. ... As a result, by the and this course, students acquire knowledge about the popular parallel programming techniques, knowledge of modern high-performance computing systems and practical skills to work with them. ... Moscow: Binom...
... However, our studies show that Prosilica EC650 has very good p erformance to use as DIMM image detector. ... The sub-directories /opt/dimm/data/out for the output data file, /opt/dimm/data/log for the output log file yymmdd-dimm.log and /opt/dimm/etc for the configuration file must b e created. ... Pictures mode The Pictures mode provides grabbing of the star b ox images and storing their sequence as one output file "b oxrecord.fits" in /opt/dimm/data/images/ sub directory. ...
[
Текст
]
Ссылки http://curl.sai.msu.ru/mass/download/doc/dimm_soft_description.pdf -- 219.2 Кб -- 23.03.2008 Похожие документы
MSU . Science Park . ... 2-4 June 2014, Moscow hosted the Third International Summit of technology parks and business incubators "Technoparks as new drivers of national economic development." ... To do this for three days at the III Summit held an educational seminar "Managing effective business incubators and technology parks" with American colleagues - Heads of existing industrial parks and technology transfer centers. ... JSC MSU Science Park. ...
... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Voting Figures Look a Bit Too Round . ... Re: Voting Figures Look a Bit Too Round [ re: Gimli ] . ... Re: Voting Figures Look a Bit Too Round [ re: Attila ] . ...
MATSYM - symbolic matrix processor . ... To use the program you will need a MAT file (liked CIR file: "User manual for CIRSYM program") of your system. ... In first string of MAT file enter any text you want to be the title of your system. ... Starting from string 2 (if is not comments - "*") enter the system element name, incident row and column and, optionally, its value. ... To generate a solution, run MATSYM.exe and enter "system_file_name.CIR" or click on the "ENTER" (in "MAT" case). ...
Space Weather . ... Space weather . ... 3D magnetosphere . ... Data . ... Magnetosphere . Solar wind forecast . Dst forecast . ... Degrees) . ... 2012 Space Monitoring Data Center . ...