... Partial reaction, angular correlation) . ... Diff.cross section d/dA for thick target) . ... Partial differential cross section d/dA) . Partial diff. cross section d/dA * 4pi/Sigma) . ... Partial diff. cross section d/dA rel. to 90 deg) . ... S-factor for partial diff. cross section) . ... Partial diff. gamma em. cross section d/dA)(Diff.partial gamma-emission cross section) . ... Fission-product yield (assumed cumulative))(Fission product yield, assumed by compiler as cumulative) . ...

Еще в разделе: (Показать все результаты (>4259) - cdfe.sinp.msu.ru/ )

• CDFE => Online services => Chart of Nuclear Quadrupole Deformations
• CDFE => Online services => Unified system
• CDFE provides the major photonuclear databases. Online Services.

... О факультете . ... Master In Ecology . ... Master (MSc) . ... A Master will be able to successfully deal with conceptual issues and practical problems related to various subflields of ecology and environmental science. ... Enables the students to develop biopolicies to deal with ecological problems caused by environmental pollution, the disruption of the ecological matrix of an area, and biodiversity-endangering factors. ... Lectures . ... Д 501.001.20 - все защиты . ... Биологический факультет МГУ ...

Еще в разделе: (Показать все результаты (>3) - www.bio.msu.ru/ )

• Master In Nanobiotechnology ? Биологический факультет МГУ

... News . ... TLE news . ... Publications on Transient luminous events . ... The UHECRs will be detected through the measurement of the emission in the range between 290 and 430 nm, where some part of Transient Luminous Events (TLEs) emission also appears. ... Luminous event parameters (atmosphere altitude, energy released to radiation, and temporal pro?les) are similar to observed elsewhere parameters of transient luminous events (TLE) of elves, sprites, halo, and gigantic blue jets types. ...

Еще в разделе: (Показать все результаты (>15) - uhecr.sinp.msu.ru/ )

• Global transients in ultraviolet and red-infrared ranges from data of
• UHECR news
• Новости КЛПВЭ

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

International Journal for Parasitology 32 (2002) 817-824 www.parasitology-online.com Host manipulation by Ligula intestinalis: a cause or consequence of parasite aggregation? ... Here we consider whether these behavioural changes are important in shaping the distribution of parasite individuals across the fish population. ... Keywords: Ligula intestinalis; Roach; Macroparasitic aggregation; Host manipulation 1. ... Inference of parasite-induced host mortality from distributions of parasite loads. ...

Еще в разделе: (Показать все результаты (>27) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2000_Longev_JEvolBio.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2007_Bonferroni_JOB.doc
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Birthweight_JEvolBio.pdf

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Algorithms for calculating parameters of virtual scenes in computer vision tasks . ...

Еще в разделе: (Показать все результаты (>134) - graphics.cs.msu.ru/ )

• Mouse Control via User's Head Movements | Лаборатория компьютерной графики и
• Mouse Control via User's Head Movements | Graphics and Media Lab

... Education in the Department starts on the third course. ... The large practical course lasts for 2 years and consists of several parts. ... This project is performed either at the Department of Biochemistry or in the friendly laboratories of the Institute of Physicochemical biology of the Moscow State University, in the Russian Cardiology Centre, in the Institute of Biochemistry or in the Institute of Bioorganic Chemistry of Russian Academy of Sciences and many other scientific institutions of...

Еще в разделе: (Показать все результаты (>38) - biochem.bio.msu.ru/ )

• Biochemistry Department of Moscow State University | Teaching staff
• Large potentials of small heat shock proteins.

... It is being organized jointly by the Byurakan Astrophysical Observatory (BAO) and the Armenian Astronomical Society (ArAS). ... LIST OF LECTURERS AND LECTURES : Dr. Vladimir AIRAPETIAN (Goddard Space Flight Center, USA): Physics of Winds from Cool Evolved Stars Dr. Don BARRY (Cornell University ... (observation techniques and theory) Dr. Michel DENNEFELD (Institut d'Astrophysique de Paris, France): Introduction to spectroscopic observations Dr. Serguei DODONOV (Special Astrophysical ...

Еще в разделе: (Показать все результаты (>53) - sai.msu.ru/ )

• Презентация PowerPoint
• European Astronomical Society(EAS): NEWS

... Квантовая теория . ... Непертурбативная низкоэнергетическая физика адронов и лептонов (руководители - проф. К.А.Свешников, проф. А.Е.Дорохов). ... Методы квантовой теории поля в физике конденсированного состояния (руководители - с.н.с. О.В.Павловский, с.н.с. М.В.Улыбышев). Кафедра активно участвует в организации и проведении ежегодных международных семинаров по проблемам квантовой теории поля и теории гравитации в ИФВЭ - Протвино. ... Phys. Rev. D 85 (2012) 094022, arXiv: 1110.6059. ...

Еще в разделе: (Показать все результаты (>4) - hep.phys.msu.ru/ )

... Simultaneous measurement of characteristics of bending and valence bands of water in D2 O solutions, KBr and KCl and using genetic algorithms in conjunction with variation methods allowed increasing accuracy of estimation of Fermi resonance coupling constant and of Fermi resonance contribution into formation of water Raman valence band. ... This energy transfer can explain existence of the shoulder in low-frequency part (in the region 3300 cm-1 ) of water Raman valence band. ...

Еще в разделе: (Показать все результаты (>21) - rswater.phys.msu.ru/ )

• http://rswater.phys.msu.ru/en/articles/2014/JBO_19_11_117007.pdf
• http://rswater.phys.msu.ru/en/articles/2014/jalcom.pdf

Neutron diffraction researches of nuclear and magnetic structure of new materials and its correlations with physical properties . Duration of training : 1 year . Supervisor of studies : A.M.Balagurov (professor, D.Sc., bala@nf.jinr.ru ) . ... In FLNP JINR there are unique opportunities for neutronography researches of nuclear and magnetic structure of crystals. ... Supervisor of studies: V.Yu.Pomjakushin (Ph. ... The near order and magnetic structure in amorphous magnetics. ...

Еще в разделе: (Показать все результаты (>21) - foroff.phys.msu.ru/ )

• Papers of our group
• The Faculty System of Education
• Мир медицинской физики

Application of the V--Ray Technology for Optimization of the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D Supercomputers Alexander S. Antonov, Vladimir V. Voevodin Moscow State University, Russia e­mail: voevodin@vvv.srcc.msu.su Abstract The paper shows an application of the so­called V­ Ray Technology for optimizing the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D supercomputers. ... Results for CRAY Y­MP supercomputers. al structure of the program. ...

Еще в разделе: (Показать все результаты (>6) - asa.guru.ru/ )

SKOBELTSYN INSTITUTE OF NUCLEAR PHYSICS (SINP) A.N. Ermakov, V.A. Khankin, Yu.A. Kubyshin, N.I Pakhomov, J.P. Rigla, V.I. Shvedunov DESIGN AND MAGNETIC MEASUREMENTS OF THE EXTRACTION MAGNET FOR 55 MeV RACE TRACK MICROTRON MSU-SINP Preprint No 2011-2/866 1 UDC 621.039 A.N. Ermakov, V.A. Khankin, Yu.A. Kubyshin, N.I Pakhomov, J.P. Rigla, V.I. Shvedunov E-mail addresses: shved@depni.sinp.msu.ru DESIGN AND MAGNETIC MEASUREMENTS OF THE EXTRACTION ... Magnetic screen system optimization.. ...

Еще в разделе: (Показать все результаты (>3) - sinp.msu.ru/ )

• http://sinp.msu.ru/en/system/files/preprints/pp-882.pdf

... Students . Phd students . Practical work . For 2 grad students . ... Grad. students . ... Work time: . Monday 10:00-15:00 . Saturday 10:00-15:00 . Signing up for practical work is possible only during work time of the practicum . ... Описание задачи . Mechanical resonance. Movement of magnetized rod in non-uniform magnetic field. ... Magnetic resonance. ... SHF Faraday effect in ferrites. ... Kerr effect. ... Hall effect. ...

Еще в разделе: (Показать все результаты (>29) - magn.phys.msu.ru/ )

• Information about education on magnetism division
• Information for PhD students
• Some materials

Moscow State University Belozersky Institute of Physico-Chemical Biology . Department of Electron Microscopy is a sub-division of A.N. Belozersky Institute of Physico-Chemical Biology . ... We are interested of how eukaryotic cell is organized, formed and functioned. Since A.N. Belozersky Institute of Physico-Chemical Biology is one of the scientific departments of Moscow State University ? ... Understanding the metaphase chromosome architecture remains a basic challenge in cell biology. ...