... I would like to invite you to visit my website http://www.againstchance.webs.com/ where I present the demonstration of my invention, the device for predicting the Future. It is a computer program which reveals the reaction of the computer to the future creation of a file, and since the command to create a file can be given to the computer in accordance with the outcome of any external event, such a reaction can predict that event, too. ...

Еще в разделе: (Показать все результаты (>15) - temporology.bio.msu.ru/ )

• A FREGIMO AMISSA - Научный адъ

... Главная Факультет политологии Новости факультета Новость . ... На заседании Ученого совета факультета политологии МГУ состоялось торжественное вручение сертификата призеру международного конкурса эссе на английском языке ?Creating the Future We Want?. Декан факультета политологии профессор А. Ю. Шутов поздравил студента III курса Павла Воробьева и вручил ему от имени организаторов конкурса сертификат за глубокое понимание и раскрытие темы. ... Поступление на факультет политологии в 2016 году . ...

Еще в разделе: (Показать все результаты (>8) - polit.msu.ru/ )

• Новости факультета

Heavy-ion collisions in modified AdS spaces Pozdeeva E.O based on work I.Ya. ... Gubser, Klebanov, Polyakov, 9802109 Witten, 9802150 The gravitational shock wave in AdS 5 space is dual to ultrarelativistic heavy-ion in 4D space-time. ... DISCREPANCY The simple holographic model gives dN c h / d s 2/ 3 The mininal black hole entropy can be estimated by trapped surface area S S trapped =A trapped / 4G N The trapped surface is surface whose null normals all propagate inward. ...

Еще в разделе: (Показать все результаты (>117) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2011/anomalous_wtb_qfthep11.pdf
• http://qfthep.sinp.msu.ru/talks2015/Qfthep_mTCA_PVolkov.pdf
• http://qfthep.sinp.msu.ru/talks/qfthep10_levchenko.pdf

A General Course of Analytical Chemistry . ... A general course of analytical chemistry is taught (including seminars, lectures and practical tasks) to students of follow deparments: . Chemical Department . ... Geological Department . Geographical Department . ... The special courses also is tought to students of III-IV year of education and postgraduate students: . Introduction to contemporary analytical chemistry . ... The collecive of Analytical Division under the direction of acad. ...

Еще в разделе: (Показать все результаты (>50) - analyt.chem.msu.ru/ )

... International Olympiad БЂњNanotechnologies БЂ“ Breakthrough to the Future!БЂќ . ... The Olympiad allows the participation of primary, secondary and high school students, BSc, MSc, PhD students, young scientists, teachers and tutors, or enthusiasts of materials sciences and nanotechnologies . ... The site www.nanometer.ru is the official portal of the International Olympiad on nanotechnologies БЂњNanotechnologies БЂ“ Breakthrough to the Future!БЂќ . ...

Еще в разделе: (Показать все результаты (>3) - www.fnm.msu.ru/ )

... Living systems depository "Noah's Ark" . ... About the project . ... The project of the Moscow State University "Noah's Ark" is dedicated to the creation of multi-functional network storage of biological material. ... Creation of temporary prototypes of living systems depository bank for storage and research of the collected material. ... Development of algorithms for the information processes analysis in living systems for receiving, filing and processing of various types of biological data. ...

Еще в разделе: (Показать все результаты (>7) - depository.msu.ru/ )

• Biological information | depozitariy
• Main grant | depozitariy

XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>3) - scon155.phys.msu.ru/ )

• Best search engines for finding scientific information in the Internet:

... With the usage of on-land and satellite altimetrical measurements data some gravity map were made, averaged on one degree trapeziums, in reductions Faja, Bouguer, Glenni, which were included in the geological-geophysical international atlases of Atlantic, Indian and Pacific oceans. ... Boldirev S.A., Gajnanov A.G., Stroev P.A. Dencital inhomogeneities in lithosphere and dynamics of development of the North-West part of the Pacific mobile belt. ... Moscow, Nedra edition, 1967. ...

Еще в разделе: (Показать все результаты (>39) - geophys.geol.msu.ru/ )

... Download NPG-explorer . ... Build nucleotide pangenome . ... Here we provide a table for 3 Brucella genomes: all: embl :CP002459 BRUMM chr1 c Brucella melitensis M28 chromosome 1 all: embl :CP002460 BRUMM chr2 c Brucella melitensis M28 chromosome 2 all: embl :CP003176 BRUAO chr1 c Brucella abortus A13334 chromosome 1 all: embl :CP003177 BRUAO chr2 c Brucella abortus A13334 chromosome 2 all: embl :CP002078 BRUPB chr1 c Brucella pinnipedialis B2/94 chromosome 1 all: ... Fix bugs....

Еще в разделе: (Показать все результаты (>6947) - mouse.belozersky.msu.ru/ )

• PLANdbAffy: probe-level annotation database for Affymetrix expression
• SVETKA, a program for multiple sequence alignments analysis

Your browser doesn't support JavaScript. For best view you need to enable JavaScript. ... Theory of Vibrations II by P.V. Elyutin . Nonlinear Optics by O.A. Aktsipetrov . Nonlinear Dynamics by P.V. Elyutin . Theoretical Foundations of Quantum Radiophysics by P.V. Elyutin . Condensed Matter Physics by A.A. Nikulin . ... Optics and Nonlinear Optics of Photonic Crystals and Superlattices by O.A. Aktsipetrov and A.A. Fedyanin . ...

Еще в разделе: (Показать все результаты (>38) - shg.phys.msu.ru/ )

• TATIANA VLADIMIROVNA MURZINA

... California Department of Education (1985), Mathematics framework for public schools, kindergarten through grade twelve. ... California Department of Education (1992), Mathematics framework for California public schools, kindergarten through grade twelve. ... California Department of Education (February 5, 1998), The California mathematics academic content standards. [ http://www.cde.ca.gov/board.html ] . ... NCTM (1998), California mathematics academic content standarts for grades K-12. ...

Еще в разделе: (Показать все результаты (>153) - www.nature.web.ru/ )

• Научная Сеть - Scientific Network

... ОТЧЕТЫ СТУДЕНТОВ О ПРАКТИКЕ В САО . Лето 2001 года . ... Гришатовой Юлии . ... Для определения лучевых скоростей, FWHM (полной ширины на половине максимума) и интенсивности линия He I 6678.15А описывалась гауссианой ( рис.1 ). ... create/icat {P1} ztsh*.bdf . execute/catalog @@ set_lambda {P2} . execute/catalog @@ timing {P2} . execute/catalog @@ phase {P2} . ... create/table {P1}.tbl . ... create/column {P1}.tbl fwhm . execute/catalog @@ add_rv_curve_point {P2} {P1}.tbl . ...

Еще в разделе: (Показать все результаты (>14) - heritage.sai.msu.ru/ )

Selected Scientific Journals . Impact Factors of Scientific Journals in 1999 . ... 0.679 DEEP-SEA RESEARCH PART II-TOPICAL STUDIES IN OCEANOGRAPHY . ... 10.088 DEVELOPMENT . ... 1.857 DEVELOPMENTAL AND COMPARATIVE IMMUNOLOGY . ... 1.535 DEVELOPMENTAL BRAIN RESEARCH . ... 9.019 DIABETES . ... 5.076 DIABETES CARE . ... 0.685 DIABETES RESEARCH AND CLINICAL PRACTICE . ... 2.417 DIABETES-METABOLISM RESEARCH AND REVIEWS . ... 2.035 DRUG AND ALCOHOL DEPENDENCE . ... 1.506 DRUG DEVELOPMENT RESEARCH . ...

Еще в разделе: (Показать все результаты (>186) - www.genebee.msu.ru/ )

• Selected Scientific Journals - Search Engines
• Основной заголовок
• BLAST Frequently Asked Questions (FAQ)

... Electronic journal Issue 4. 10 september 2004 Bonham G.M., Surin A. IP Videoconferencing in Graduate Professional Education: Collaborative Learning for Public Management Introduction. ... While technology offers a range of opportunities that a standard «chalk and talk» class could never match, questions about the educational value of the new digital media loom large. ... If so, how can technology more effectively promote student-centered learning? ... Collaborative IP Videoconferencing. ...

Еще в разделе: (Показать все результаты (>10) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./leigh.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf

... Modeling of Temperature Field in Tissue Created by Therapeutic Phased Arrays with Regular and Random Distribution of Elements . ... Numerical algorithms for modeling of arbitrary three-dimensional acoustic and temperature fields in biological tissue are developed. Spatial distributions of acoustic intensity and temperature patterns in tissues created by two-dimensional therapeutic phased arrays with regular or random distribution of circular elements on a spherical shell are investigated. ...

Еще в разделе: (Показать все результаты (>79) - acs366.phys.msu.su/ )

• AUTHOR : Filonenko E
• AUTHOR : Gavrilov L

... Publications . ... Laboratory of Mathematical Methods of Image Processing . Chair of Mathematical Physics . ... Lomonosov Moscow State University . ... Publication type . Conference paper . ... Publication date . ... Conference . 17-th International Conference on Computer Graphics GraphiCon'2007 . ... Moscow, Russia . ... BookTitle = {17-th International Conference on Computer Graphics GraphiCon'2007}, . ... Address = {Moscow, Russia}, . ...

Еще в разделе: (Показать все результаты (>127) - imaging.cmc.msu.ru/ )

• Ringing effect modeling | Laboratory of Mathematical Methods of Image...
• Basic edges | Laboratory of Mathematical Methods of Image Processing
• Ringing analysis - database | Laboratory of Mathematical Methods of Image

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>22) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Nhunt

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>57) - electr003.chem.msu.ru/ )

• Department of Electrochemistry
• Veronika K. Laurinavichyute overflow
• Boris B. Damaskin

. ЭКОЛОГИЧЕСКАЯ ИНФОРМАЦИЯ . WEB- ориентированная библиографическая база данных .

Еще в разделе: (Показать все результаты (>4) - ecoinformatica.srcc.msu.ru/ )

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ THE NEW GRIDDED KURIL-KAMCHATKA BATHYMETRY FOR TSUNAMI MODELING An. ... For calculations in each grid point where the depth is to be found the algorithm uses up to 9 points from data source. ... Then the spline interpolation is used for defining the depth value in the grid-point. ... Hydrographic Survey Data, CD-ROM data set, Ver. ...

Еще в разделе: (Показать все результаты (>33) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E09_Karlik.pdf
• http://seac47-2.phys.msu.ru/proc/Recommendations.pdf
• Database search page