... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>4) - sinp.msu.ru/ )

Transhumus : Integrated software solution for interpretation of FT-ICR mass spectra of natural organic matter Anton Grigoryev1, 2, Alexey Kononikhin 1 2 2, 3 , Irina Perminova4, Eugene Nikolaev2, 3 ansgri@gmail.com Institute for Energy Problems of Chemical Physics, Moscow , Russia 3 Institute of Biochemical Physics, Moscow , Russia 4 Lomonosov Moscow State University, Moscow , Russia Natural organic matter ( ... However, there still are problems with interpretation of mass spectra of NOM. ...

Еще в разделе: (Показать все результаты (>111) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2010/2010-vladimirov-combination.pdf
• http://www.mgumus.chem.msu.ru/publication/2010/2010-kazachkov-optimization.pdf
• List of participants

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

XXVIII General Assembly of the IAU, SPS15 Beijing, August 31, 2012 . N.N. Samus, S.V. Antipin "Variable Stars and Data-Intensive Astronomy" . During the 26th IAU General Assembly in Prague, the IAU Division V (Commissions 27 and 42) considered the future of variable-star catalogues. ... To discuss these problems and to look for their solutions, the IAU Commission 27, on behalf of the IAU Division V, created an informal working group, chaired by the GCVS editor, Dr. Nikolai Samus. ...

Еще в разделе: (Показать все результаты (>77) - sai.msu.ru/ )

• Презентация PowerPoint

... Геология >> Геотектоника | ... Добавить новое сообщение . ... Учебное пособие "Введение в тектонофизику". Гончаров М. А., Талицкий В. Г., Фролова Н. С. Ответ. ... Тезисы научной конференции ЛОМОНОСОВСКИЕ ЧТЕНИЯ, ноябрь 2011 года СЕКЦИЯ ГЕОЛОГИЯ: . ...

Еще в разделе: (Показать все результаты (>14) - phys.web.ru/ )

Here is a list of previous events held by our Department. April 23, 2012 . Round Table Repeated Speech: Between a Commonplace and an Artistic Experiment held as a part of the Lomonosov Readings conference. ... Lecture Language, Culture and Hegemony: Rethinking the Politics of Culture in the єбє¬ntext of the Russian Revolution . ... Round Table . ... November 30, 2011 . ... Round Table Reading a Monument: A Memorial Place in the City (held as a part of the conference Polyphony of the City ). ...

Еще в разделе: (Показать все результаты (>13) - discours.philol.msu.ru/ )

... SINP MSU . ... JINR . ... Institute for Nuclear Problems . ... Yerevan Physics Institute . ... University of Maryland . ... IHEP . ... vladimir . ... petrov@mx.ihep,Vladimir.Petrov@cern.ch . ... VLK@sinp.msu.ru . ... dubinin@theory.sinp.msu.ru . ... Institute for High Energy Physics . ... grandr@lav01.sinp.msu.ru . ... irina@lav01.sinp.msu.ru . ... Institute of Physics NAS . ... Alexander . ... e@lav01.sinp.msu.ru . ... snigirev@lav01.sinp.msu.ru . ... St Petersburg Nuclear Physics Institute . ...

Еще в разделе: (Показать все результаты (>48) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/~vlk/report_E852.ps
• Etapi- Comments 3/1/97
• Activity of Igor Lokhtin

Summary Progress Report 2010 ­ 2014 UNESCO Chair on Global Problems and Emerging Social and Ethical Challenges for Large Cities and Their Population at the Faculty of Global Processes of the Lomonosov Moscow State University Period of activity: September 2010 June 2014 Title of the Chair : UNESCO Chair on Global Problems and Emerging Social and Ethical ... Visit of UNESCO Director-General Irina Bokova at Moscow State University September 9, 2011. ...

Еще в разделе: (Показать все результаты (>62) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-2.pdf
• http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GLOBAL%20STUDIES.pdf

... ASA . ... Master net Homepage . ... SAI MSU 20-21 March 2014 . ... Homepage . ... YaB-100 conferences . online . ... YaB-100 conferences, March 20 morning session. YaB-100 conferences, March 20 evening session. ...

Еще в разделе: (Показать все результаты (>201) - master.sai.msu.ru/ )

• YaB-100 - Participants
• Ya.B. Zeldovich All-Moscow Seminar of Astrophysicists

... This course is dedicated to the main principles, methods and techniques of parallel programming oriented at resolution of resource-intensive tasks physically and in non-linear optics in particular. The course offers profound description of popular techniques of parallel programming such as OpenMP and MPI. ... Rapid growth of productivity of the modern computing systems is achieved by using parallel processors and multicore systems. ... Antonov, A.S. Parallel Programming Using MPI. ...

Еще в разделе: (Показать все результаты (>54) - engineering.phys.msu.ru/ )

• Jumping Robot

... Upstream open reading frames regulate translation of the long isoform of SLAMF1 mRNA that encodes costimulatory receptor CD150. ... More than 40% of human genes contain upstream open reading frames (uORF) in their 5'-untranslated regions (5'-UTRs) and at the same time express at least one truncated mRNA isoform containing no uORF. ... CD150 is a member of the CD2 superfamily, a costimulatory lymphocyte receptor, a receptor for measles virus, and a microbial sensor on macrophages. ...

Еще в разделе: (Показать все результаты (>20) - biochem.bio.msu.ru/ )

• Sulfated and sulfonated polymers are able to solubilize efficiently the protein

О кафедре . ... Динамические задачи теории упругости . Динамика пластин и оболочек . ... Методы теории упругости . ... Нелинейная теория упругости . ... Пластины и оболочки . ... Теория и расчет оболочек тонкостенных летательных аппаратов . ... Теория упругости структурно-неоднородных тел . ... Уравнения изгиба пластин классическая линейная теория. ... Колебания пластин. ... Oscillation of plates . ... МГУ им. М.В.Ломоносова, механико-математический факультет, кафедра теории упругости . ...

Еще в разделе: (Показать все результаты (>4) - elast.math.msu.su/ )

. Коуровская тетрадь . Новосибирск . Another list of open problems . New York .

Еще в разделе: (Показать все результаты (>26) - halgebra.math.msu.su/ )

• staff:guterman:conf_engl.html | Кафедра высшей алгебры
• staff:guterman:publ_engl.html | Кафедра высшей алгебры
• staff:guterman:conf_rus.html | Кафедра высшей алгебры

... Заведующий лаборатории - профессор А.В. Немухин . ... IV Международный симпозиум "Topical Problems of Biophotonics", 21-27 июля , Нижний Новгород Приглашенный доклад: М.Г. Хренова , А.В. Немухин, А.П. Савицкий "Molecular modeling of the Forster resonance energy transfer between fluorescent proteins" . ... Конференция Biocatalysis-2013, 2-7 июля Москва Доклад: А.В. Немухин "Molecular mechanisms of the enzymatic hydrolysis reactions of nucleotide triphosphates" . ...

Еще в разделе: (Показать все результаты (>20) - lcc.chem.msu.ru/ )

The final deadline for pre-registration and abstract submission is 20 May 2002. ... Workshop Proceedings are available for download. 30 Sep 2002 . Information on Workshop Proceedings . 28 Aug 2002 . Venue of the Workshop . 12 Jul 2002 . Workshop program is available now! ... 24 May 2002 . Visas to Russia? ... Information on accomodation in Petropavlovsk. New topic "1952 Kamchatka tsunami" was added. ... Information . ... Tel: 7(095) 939-3698 Fax: 7(095) 124-8713 . ...

Еще в разделе: (Показать все результаты (>22) - seac47-2.phys.msu.ru/ )

• LOCAL TSUNAMI WARNING AND MITIGATION -- Official information

... Презентация по машинному переводу от Google на коллоквиуме по базам данных в МГУ . 2-го июня в 11:00 во 2-м учебном корпусе МГУ (здание факультета ВМиК МГУ) состоится презентация исследователя из Нью-Йоркского отделения Google на тему: "Building a Large-Scale Machine Translation System" ("Построение масштабируемой системы машинного перевода"). ... Презентация проводится на английском языке; аннотация презентации и информация о докладчике представлена ниже: . ... 2003 2011 MsuNews.Ru Новости МГУ . ...

Еще в разделе: (Показать все результаты (>16) - www.msunews.ru/ )

• MsuNews.Ru | Новости МГУ | Grant program of McKinsey Company Business

... hall in front of room 01, MSU, Main Building . ... room 01, MSU, Main Building . ... Silvia Chelala (Empire State College, State University of New York, Old Westbury, New York, USA) Designing and Teaching Introductory Spanish as a Foreign Language at a Distance . ... FFL, recreation hall, 3rd floor . ... FFL, room 519 . ... FFL, room 501 . ... FFL, . room 107-108 . ... Internet-Supported Teaching . ... FFL, room 106 . ... FFL, room 416 . ... FFL, room 420 . ... FFL, room 210 . ...

Еще в разделе: (Показать все результаты (>10) - anazarenko.ffl.msu.ru/ )

... Expanding and Retaining Customer Loyalty with Stefan Legner of InterNetX . Legner started with a brief history of InterNetX, a Regensburg, Germany based hosting and domain registrar provider that has more than 19,500 customers worldwide.He emphasized the need for companies to build long term partnerships, adding that business has always been about the relationship between people rather than companies .Where possible, Legner said that companies should provide an ... cheap the north face . ...

Еще в разделе: (Показать все результаты (>76) - elana.sinp.msu.ru/ )

• ralph lauren outlet uk 6 million cars worldwide | С Днем Победы!
• editor | С Днем Победы!
• cheap moncler uk 4 16v loss of oil pressure at 2000rpm | С Днем Победы!

The Octotron Approach: Towards Autonomous and Reliable Operation of Supercomputers Alexander Antonov, Dmitry Nikitenko, Pavel Shvets, Sergey Sobolev, Konstantin Stefanov, Vadim Voevodin, Vladimir Voevodin, Sergey Zhumatiy Research Computing Center, Lomonosov Moscow State University, Moscow, Russia {asa,dan,shpavel,sergeys,cstef,vadim,voevodin,serg}@parallel.ru 1 Introduction ... 2 The Octotron System: Model-based Approach Octotron represents the supercomputer model in the form of a graph (Fig. ...

Еще в разделе: (Показать все результаты (>43) - hpc.msu.ru/ )

• APPLICATIONS: Condensed Matter Physics | Moscow University Supercomputing...
• APPLICATIONS: Theoretical Physics | Moscow University Supercomputing Center
• APPLICATIONS: Electronics and Acoustics | Moscow University Supercomputing

ФАКУЛЬТЕТ ФУНДАМЕНТАЛЬНОЙ . ФИЗИКО-ХИМИЧЕСКОЙ ИНЖЕНЕРИИ . ... физико-химический факультет) . ... О ФАКУЛЬТЕТЕ . ОСНОВНАЯ ИНФОРМАЦИЯ . ... ОТЛИЧНИКИ ФАКУЛЬТЕТА . ... КОНТАКТЫ . ... ФАКУЛЬТЕТА . ОЗНАКОМИТЬСЯ С ОБЩЕЙ ИНФОРМАЦИЕЙ О ФАКУЛЬТЕТЕ, НАПРАВЛЕНИЯМИ И СПЕЦИАЛЬНОСТЯМИ . ... ВСЯ ИНФОРМАЦИЯ . ... Факультет фундаментальной физико-химической инженерии 2006 - 2016 . ...