... School problem is extremely important. ... Our President has mentioned the territorial disparity, i.e. two-thirds of our schools are the rural schools and their graduates are at unequal terms with their equals from cities' schools to get following education. ... Create special conditions in education for disabled children, for orphans and children from unfortunate families, pupils from rural schools and gifted children. ... Ensure social equity for all children during school education and after it. ...

Еще в разделе: (Показать все результаты (>19) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/396.doc
• http://www.rsr-online.ru/doc/norm/94.doc
• http://www.rsr-online.ru/doc/norm/111.doc

... Issues of the year 2010 . ... Instructions for Authors . ... The scientific English language journal ‘GEOGRAPHY, ENVIRONMENT, SUSTAINABILITY’ aims at informing and covering the results of research and global achievements in the sphere of geography, environmental conservation and sustainable development in the changing world. ... In the text the surname of the author and the year of publication of the reference should be given in square brackets, i.e. [Author1, Author2, 2008]. ...

Еще в разделе: (Показать все результаты (>193) - www.geogr.msu.ru/ )

• rlmht
• hurum
• CONTENTS ? 6 - 2013

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Skip to main content . ... Факультет биоинженерии и биоинформатики Московского Государственного Университета имени М.љВ.љЛомоносова открывает экспериментальный набор на обучение по программе повышения квалификации ? Исследование природы вместе с детьми ?. Обучение платное, стоимость ? ... Программа ?ИССЛЕДОВАНИЕ ПРИРОДЫ ВМЕСТЕ С ДЕТЬМИ? предназначена для повышения квалификации педагогов и родителей, заинтересованных в привлечении детей к исследованию природы. ... Ученые ? детям ? ...

Еще в разделе: (Показать все результаты (>1634) - www.kids.genebee.msu.ru/ )

Site navigation: . ... Publications . ... SPDC Laboratory . Quantum Electronics Chair . ... Site configuration . Error: You currently have Javascript disabled. ... The problem of preparing entangled pairs of polarization qubits in the frequency-nondegenerate regime?, ... Download [ help ]: . Download paper: doi page . Download paper: Full text . ... All persons copying this information are expected to adhere to the terms and constraints invoked by each author's copyright. ...

Еще в разделе: (Показать все результаты (>72) - qi.phys.msu.ru/ )

• Sergei Kulik: Scientific interest
• Home :: Quantum Information Laboratory

COMPUTER DESIGN OF HETEROCYCLIC RING-OPENING REACTIONS. ... Since the cleavage of ring bond requires appearance of new bond either between th e (endo) atoms of initial cycle, or between initial cycle and external (exo) group, the first case is treated as endoopening, and the another as exo-opening: Endo-Ring Opening Exo-Ring Opening © 1995 American Institute of Physics 75 7 758 Heterocyclic Ring-Opening Reactions General Methodology and Algorithms 1. ... RULE FOR ENDO-TYPE RJNG OPENING. ...

Еще в разделе: (Показать все результаты (>91) - www.chem.msu.ru/ )

• Scientific conference Women in chemistry: biographical portrait, contribution
• Intuitive Chemical Topology Concepts

... Laboratory of Problems for Magnetism, . ... Study of the magnetic and transport properties of R-3d intermetallic compounds with a magnetic instability of the itinerant-electron subsystem. ... const at high temperatures (Curie-Weiss law) [A.S. Markosyan, Y. Hosokoshi, K. Inoue, Phys. Lett. ... Gaidukova, Y. Hosokoshi, K. Inoue, A.S. Markosyan , Magnetic phase diagram and pressure effect on the magnetic properties of the Y 1? x Gd x Mn 2 intermetallic compounds, J. Phys.: Condens. ...

Еще в разделе: (Показать все результаты (>18) - ferro.phys.msu.ru/ )

• Department of General Physics and magneto-ordered matter. Physics Faculty of
• Physics Department of Moscow State University

... PhD thesis title: Gauge dependence of effective action in quantum gravity. ... Research fields of interest . Combustion: nonlinear development of the Darrieus-Landau instability of premixed flames, nonlinear flame stabilization and steady flame propagation, asymptotic methods, small gas expansion limit, non-perturbative description of curved flames, flame propagation in gravitational field, propagation of diffusion flames in counterflows. ... Gauge-independent effective gauge fields. ...

Еще в разделе: (Показать все результаты (>11) - theorphys.phys.msu.ru/ )

Summary Progress Report 2010 ­ 2014 UNESCO Chair on Global Problems and Emerging Social and Ethical Challenges for Large Cities and Their Population at the Faculty of Global Processes of the Lomonosov Moscow State University Period of activity: September 2010 June 2014 Title of the Chair : UNESCO Chair on Global Problems and Emerging Social and Ethical ... Visit of UNESCO Director-General Irina Bokova at Moscow State University September 9, 2011. ...

Еще в разделе: (Показать все результаты (>41) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-2.pdf

... News . About choir . ... Performance the Academic Choir of the Moscow State University in Crocus City Hall . ... Bishop Tikhon opened the choir of Moscow State University in Vienna . Choir of Moscow State University spoke at the Vienna branch of the United Nations . ... Posted in: News . Sorry, this entry is only available in Русский . ... Older Entries . ...

Еще в разделе: (Показать все результаты (>6) - new.choir.msu.ru/ )

• News | Academic choir of Moscow State University - Part 2

О кафедре . ... Динамические задачи теории упругости . Динамика пластин и оболочек . ... Методы теории упругости . ... Нелинейная теория упругости . ... Пластины и оболочки . ... Теория и расчет оболочек тонкостенных летательных аппаратов . ... Теория упругости структурно-неоднородных тел . ... Уравнения изгиба пластин классическая линейная теория. ... Колебания пластин. ... Oscillation of plates . ... МГУ им. М.В.Ломоносова, механико-математический факультет, кафедра теории упругости . ...

Еще в разделе: (Показать все результаты (>2) - elast.math.msu.su/ )

. Коуровская тетрадь . Новосибирск . Another list of open problems . New York .

Еще в разделе: (Показать все результаты (>14) - halgebra.math.msu.su/ )

• staff:guterman:conf_engl.html | Кафедра высшей алгебры
• staff:guterman:publ_engl.html | Кафедра высшей алгебры
• shared:seminars_lnd | Кафедра высшей алгебры

... Заведующий лаборатории - профессор А.В. Немухин . ... IV Международный симпозиум "Topical Problems of Biophotonics", 21-27 июля , Нижний Новгород Приглашенный доклад: М.Г. Хренова , А.В. Немухин, А.П. Савицкий "Molecular modeling of the Forster resonance energy transfer between fluorescent proteins" . ... Конференция Biocatalysis-2013, 2-7 июля Москва Доклад: А.В. Немухин "Molecular mechanisms of the enzymatic hydrolysis reactions of nucleotide triphosphates" . ...

Еще в разделе: (Показать все результаты (>7) - lcc.chem.msu.ru/ )

Magnetism Department MSU . ... Research groups . ... Students . Phd students . ... The basics of spintronics. prof . Vedyaev ю. Actual problems in modern magnetism . prof . Granovsky A. The physical basics of magnetism . associate prof . Kotel'nikova O. Magnetic phase transitions. associate prof . Kotel'nikova O. Physics of magnetic phenomena. associate prof . Kotel'nikova O. Introduction in group theory and its application in physics of magnetic phenomena. associate ...

Еще в разделе: (Показать все результаты (>14) - magn.phys.msu.ru/ )

• Information about education on magnetism division
• Полезные ссылки

... Davis Center for Russian Studies at Harvard University. The Center aims at developing of fundamental knowledge about Russia, its culture, and its institutions. The Center also examines Russia in its regional and historical context, and welcomes and supports the study of neighboring countries that have been either integrated with, or subordinated to, the Russian state at various periods in history, or whose experience poses intellectual problems similar to those of Russia. ...

Еще в разделе: (Показать все результаты (>13) - suny.msu.ru/ )

... Here is a brief outline of the current theory of the events in the early history of the solar system: . A cloud of interstellar gas and/or dust (the "solar nebula") is disturbed and collapses under its own gravity. ... The gas cools off enough for the metal, rock and (far enough from the forming star) ice to condense out into tiny particles. (i.e. some of the gas turns back into dust). ... Once the larger of these particles get big enough to have a nontrivial gravity, their growth accelerates. ...

Еще в разделе: (Показать все результаты (>2) - www.iki.rssi.ru/ )

• Nine Planets Technical Help

... ESA Space Weather Activities | ... Space Environments and Effects Analysis Section, | ... Introduction THE NATURAL SPACE ENVIRONMENT REPRESENTS A CONSIDERABLE HAZARD FOR SPACECRAFT AND THE EUROPEAN SPACE AGENCY (ESA) HAS FOR MANY YEARS TAKEN MEASURES TO ENSURE THAT ITS SPACECRAFT ARE ABLE TO SURVIVE AND OPERATE IN IT. ... 2.2 Radiation Effects As in other space agencies, ESA's concerns with space weather effects probably began with concerns over radiation effects on spacecraft systems. ... 2000). ...

Еще в разделе: (Показать все результаты (>269) - www.kosmofizika.ru/ )

• http://www.kosmofizika.ru/katalog/e06/event2006_12_13.doc
• http://www.kosmofizika.ru/pdf2/cosr560_1.pdf
• CRRES 560

... The author points to the potential value of an investigation of Prescriptivism not limited to the problems specific to a single language. Key words: Prescriptivism, standard language, comparative linguistics. ... No one felt competent to judge the quality or correctness of anyone else's use of the language. ... So when comparing usage problems in more than one language, one must consider both the possibility of a formal analogy and the possibility of a functional analogy. ...

Еще в разделе: (Показать все результаты (>62) - ffl.msu.ru/ )

• http://www.ffl.msu.ru/future-students/lingua-4-teens/tezis-filosof.pdf
• http://www.ffl.msu.ru/future-students/lingua-4-teens/progr.pdf

... hall in front of room 01, MSU, Main Building . ... room 01, MSU, Main Building . ... Silvia Chelala (Empire State College, State University of New York, Old Westbury, New York, USA) Designing and Teaching Introductory Spanish as a Foreign Language at a Distance . ... FFL, recreation hall, 3rd floor . ... FFL, room 519 . ... FFL, room 501 . ... FFL, . room 107-108 . ... Internet-Supported Teaching . ... FFL, room 106 . ... FFL, room 416 . ... FFL, room 420 . ... FFL, room 210 . ...

Еще в разделе: (Показать все результаты (>12) - anazarenko.ffl.msu.ru/ )

Curriculum Vitae . ... Lomonosov Moscow State University , Faculty of Computational Mathematics and Cybernetics . ... Lomonosov Moscow State University , Faculty of Physics . ... 2010 - till now . ... Research Scholar . ... Scholarship supporting perspective young scientists and teachers of Lomonosov Moscow State University who achieved significant results in teaching and research . ... Kurchatov Scholarship for excellent students of the Faculty of Physics, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>13) - oc.cs.msu.ru/ )