НЕЛИНЕЙНЫЕ ВОЛНЫ В ДНК. АНАЛИТИЧЕСКИЕ ИССЛЕДОВАНИЯ И КОМПЬЮТЕРНОЕ МОДЕЛИРОВАНИЕ . ... Обсуждаются и сравниваются результаты аналитических исследований и компьютерного моделирования нелинейных конформационных волн в ДНК. ... Показано, что с помощью компьютерных методов удается получить новые нелинейные волновые решения, которые не удавалось получить аналитическими методами. ... These waves are the solutions of the equations describing large-amplitude rotational motions of DNA bases. ...
... Grant of the Russian Foundation for Basic Research (RFBR) No. 16-32-00882 for 2016-2017 "The creation of fluorescent biomarkers on the basis of nanodiamonds and optimization of their properties for targeted delivery of drugs and monitoring their excretion" (headed by K. A. Laptinskiy) . ... Grant of the Russian Foundation for Basic Research (RFBR) No. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...
... Международные: . ... NICA-MPD . МЕЖДУНАРОДНЫЕ ПРОЕКТЫ. ... российский коллайдер протонов и тяжелых ионов, строящийся с 2013 года на базе Лаборатории физики высоких энергий (ЛФВЭ) им. В. И. Векслера и А. М. Балдина Объединенного института ядерных исследований (ОИЯИ), в городе Дубна Московской области. ... Ускорительный комплекс создается с целью исследования области физики частиц в ранее недоступной области параметров и условий эксперимента ? ...
. Лаборатория биофизики клетки: Объявления о семинарах и др. / . archives . Правка . Недавние изменения . Настройки . You need to use the ikiwiki-calendar program to generate calendar-based archive pages. Ссылки: sidebar . Редактировалось в последний раз Sun Oct 11 21:47:07 2015
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Uneex . SeminarFeature . ... Определение спама как нежелательной почты в противовес массовой рассылке . Классические методы защиты от спама и их недостатки . ... Методы, основанные на поведении спамера: Greylisting , TMDA и т. п. Основной источник спама, обходящего классические методы защиты . ... Общая схема построения (feature-based) классификаторов . ... Copyright 2003 by the contributing authors. ... Send feedback to svv at cmc dot msu dot ru. ...
The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of November 2009, the database (both the software and the content) is in its development/testing phase. Sternberg Astronomical Institute ...
... High Power Linear Accelerators . Fig 3a: One-section schematic . ... Our CW LINAC family consists of ten accelerators each with beam currents of 50 mA and energies ranging from 0.6 to 6 MeV in increments of 600 keV with corresponding beam power of 30 to 300 kW. ... Fig 4a: Two-section schematic . ... Our two-section CW LINAC seen in Fig. 4 consists of one-section CW LINAC, beam line between first and second AS, and second AS which accelerates the 50 mA beam up to the energy 1.2 MeV. ... 0.6 MeV . ...
... Форумы > Аспирантура > Тема . Автор темы ter . Форумы Список тем Новая тема . ... PhD positions in logic and AI, Vancouver (Canada) . PhD positions are available in the area of logic-based artificial intelligence. ... interested in logic (or discrete mathematics) and its uses for practical problem solving. ... Online application information is available at: . ... Следующая тема Предыдущая тема . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...
. Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . Water and Environment Journal . Weed Biology and Management . Weed Research . Winterthur Portfolio . WorkingUSA . World Banking Abstracts . World Englishes . World Oil Trade . Worldviews on Evidence-Based Nursing . Wound Repair and Regeneration . (495) 939-16-96, 939-42-04 . Copyright ї 2004 mailto:lib@phys.msu.su . Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . Разработано EA Studio .
... A comparative study of thermodynamic for both natural and artificial RNA/DNA protein complexes would establish bases for a specificity of complex formation. In particular, we have shown that aptamers could be used for a direct measuring of thrombin enzymatic activity in a solution. D 2002 Published by Elsevier Science B.V. Keywords: RNA/DNA protein interactions; Ribosome; SELEX; RNA/DNA aptamers; Thrombin; Enzymatic activity 1. ... The aptamer binds to the protein with Kd = 0.5 nM. ...
[
Текст
]
Ссылки http://rnp-group.genebee.msu.su/pdfs/article_vas_bioelectro.pdf -- 140.7 Кб -- 21.10.2002
[
Текст
]
Ссылки http://rnp-group.genebee.msu.ru/pages/pdf/bioelectro2002.pdf -- 140.7 Кб -- 18.02.2008 Похожие документы
This page is devoted to information on Supernova 1999gi in NGC 3184 . ... Information on the original web pages for many of these images can be found on the Supernova links web page. ... NGC 3184 is a fairly close Mag 10.3 galaxy, only about half as distant as the Virgo cluster. ... Seiichi Yoshida has a 1999gi page . Odd Trondal's 1999gi page . ... CfA image . ... 14.5 . ... Jean Marie Llapasset image . ... vsnet-alert 3805 ] SN 1999gi in NGC 3184 . vsnet-chat 2438 ] Host galaxy of SN1999gi . ...
COACHES . ... Kiseljev Dmitri . Head Coach . ... Lukyanchikov Dmitri . First Base coach, Power Lifting coach . ... Komissarov Dmitri . 3rd Base coach, Power Lifting coach . ... Erjemkin Alexey . ... Chichaev Ivan . ... Rich Reddrop* . ... Frolikov Alexey . ... Kudrjashov Alexander . ... Chichaev jr . ... Ned Reddrop* . ...
Academic English English for Students of Mathematics and Mechanics Supplementary Exercises Part II L.N.Vygonskaya O.Y.Sviridenko MSU Moscow 2012 Academic English (part 2 of 4) The tasks are based on «English for Students of Mathematics and Mechanics» by Y.I. Mindeli. Unit 1 Task 18. ... 1 Armer, T. Cambridge English for Scientists, Cambridge, 2011 4 Academic English (part 2 of 4) Unit 7 Midterm test Unit 8 (At home) Make up a list of linking words you know and bring it to class. ... Task 15 p.93. ...
[
Текст
]
Ссылки http://www.eng.math.msu.su/download/Academic_English_part2.pdf -- 877.4 Кб -- 29.08.2012 Похожие документы
... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...
The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...
... Магистерское образование . ... Магистерские программы . ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Open Information systems? and ?Network software?. ... Are researched the most frequently used applied protocols of net security and protocol of creating virtual private nets. ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Program devices of net?. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...
The subject of cybernetics is quickly growing and there now exists a vast amount of information on all aspects of this broad-based set of disciplines. ... The fields of application are virtually unlimited and applications are discovered in the investigation or modelling of any complex system. The most obvious applications have been in the construction of artificially intelligent systems, the brain and nervous system, and socio-economic systems. ...
... Home Our Team Staff Lora S. Nikolaeva . ... Kalinin, USSR; graduated from Lomonosov Moscow State University, Mechanics and Mathematics Department in 1961. Work at Lomonosov Moscow State University, Chemistry Department from 1967. ... Joint investigstions with Department of Chemistry of Tver State University and Biology Department of Lomonosov Moscow State University have been made. ... Colloquium on 24.12.12 20 Dec 2012 . ... Department of Chemistry . ... Laboratory of Chemical Thermodynamics . ...