... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
To use Microsoft Outlook Web access, browser settings must allow scripts to run. ... If your browser does not support scripts, you can download Microsoft Internet Explorer for access to Outlook Web Access. ... Select this option if you use Outlook Web Access on a public computer. ... This is a private computer . ... Use Outlook Web Access Light . ... Type the address for Outlook Web Access into the field, click Allow, and then click OK to save your changes. Connected to Microsoft Exchange . ...
... January, 2006 . ... Moscow State University Russian Language Centre . Moscow State University . ... Learn Russian at the Moscow State University! ... Group or individual lessons, living in the Russian family will help you to know Russia better. www.rlcentre.com . ... 2nd Annual Russian Winter Festival, a successful celebration of the unique relationship between London and Moscow, took place on Trafalgar Square on Saturday 14 January 2006. (more.. ...
X 1. y = f (x ) , Left = Right y (1) = 2 , y (1), y (1) . Left = Right 2. u (x , y ), v (x , y ) Left = Right u (1, 2) = 3, v (1, 2) = 4 . du, dv , ux (1, 2) . 3. F (z x , z y , z , x , y ) = 0 z (x , y ) w (u, v ) f1(x, y, z, u, v, w ) = 0, f2 (x , y, z, u, v, w ) = 0, f3 (x , y, z, u, v, w ) = 0 . 4. u x , y . 5. C u x , y, z F x , y, z = 0 . () ( ) ( )
Annu. ... Key Words stellar energy production, Nobel Prize, supernova, binary pairs s Abstract Astrophysics has been an important part of my personal and scientific life three times. ... Gamov suggested to one of his graduate students, Charles Critchfield, that he actually calculate the proton-proton reaction. ... In stars, the proton-proton reaction is usually followed by a chain of reactions with the end result of producing 4He. ... In 1938, they suggested energy production in stars. ...
... Printed in U.S.A. ( YOUNG STELLAR NUCLEI IN THE LENTICULAR GALAXIES. ... We пnd a rather young stellar nucleus, with a mean population age of 1.5 ^ 0.5 Gyr, which is more metalrich than the bulge at RB 1 kpc by an order of magnitude. ... But the center of a galaxy is a special place ; the stellar nucleus may have a particular evolution that di+ers from the evolution of the whole galaxy. ... We have detected intermediateage stellar popu lations in the centers of these galaxies. ...
... Dubna & our Venue . ... Dubna branch of the Skobeltsyn Institute of Nuclear Physics, Moscow State University . ... Dubna is located 120 km north of Moscow on the Volga river banks. ... The trains from Moscow to Dubna depart from Savelovsky railway ("Savelovskaya" metro station). there are two railway stations in Dubna: station "Bolshaya Volga" and terminal "Dubna". ... There are two railway stations in Dubna: station "Bolshaya Volga" and terminal station "Dubna". ... from station 'Dubna' . ...
... Printed in Great Britain 0021-8928/01/$-see front matter PARAMETRIC RESONANCE IN SYSTEMS WITH SMALL DISSIPATION"f A. A. MAILYBAYEV and A. P. SEYRANIAN Moscow (Received 14 December 2000) A linear oscillatory system having multiple degrees of freedom with periodic coefficients is considered. ... For an arbitrary periodic exitation matrix and a positive-definite matrix of the dissipative forces, general expressions are obtained for the domains of fundamental and combination resonances. ...
[
Текст
]
Ссылки http://mailybaev.imec.msu.ru/papers/MailybaevSeyranian2001.pdf -- 1013.4 Кб -- 14.06.2005 Похожие документы
... trans "Lomonosov Moscow State University" %} Государственный астрономический институт имени П.К.љШтернберга . ... Свинкин Д. С. НАБЛЮДЕНИЯ КОРОТКИХ ГАММА-ВСПЛЕСКОВ В ЭКСПЕРИМЕНТЕ КОНУС-ВИНД (Свинкин Д.С., ИТФ им.А.Ф.Иоффе) . ... Свинкин Д. С. Исследование коротких гамма-всплесков (GRB), которые, как считается, генерируются при слиянии компактных объектов и могут сопровождаться всплесками гравитационных волн, в настоящее время является актуальным направлением астрофизики высоких энергий. ...
... ADSP2181 Data Sheet. ... ********************* ********* * * This sample program is organized into the following sections: * * Assemble time constants * Interrupt vector table * ADSP 2181 intialization * ADSP 1847 Codec intialization * Interrupt service routines ********************************************************* ********* .module/RAM/ABS=0 loopback; {************* ... transmit i? 68 |||! |||! |||+============= control bit ||+-------------|+--------------control bit +---------------- ! ...
Geology at Moscow State University . ... In 1804 the Chair of Mineralogy and Rural Home Economics was established at the Department of Physical and Mathematical Sciences. ... Geological education at Moscow State University is an important link in the whole system of higher education of the Russian Federation, and being the major educational and scientific centre of the country the Geology Faculty coordinates the work of other academic universities in the field of geological education. ...
... About hotel . ... The hotel ?69th Parallel? is glad to present its renewed website which now has an option of online booking! ... Great stay! dns_support@antihotmail.com . ... Great hotel! ... best place in Murmansk that I've stayed! ... Stay was great. ... Always nice to have a good nights rest while enroute to my destinations. ... Very nice place . ... What a beautiful place, we enjoyed our stay! ... Best place ever! ... Next time we visit Murmansk we will definitely stay in this hotel. ... Good ....
... Politeness Strategies One of typical politeness strategies in English is softening orders, requests, critical opinions, etc., by asking a question instead of making an imperative sentence or a statement. ... N 1 2 3 4 5 6 7 8 9 10 Question Why don't you speak to him directly? ... You don't seem to know his home address, do you? ... Would you like some coffee? ... Could I see your tickets? Do you mind if I asked my friend to go with us? ... Do you mind if I asked my friend to go wit us?) ...
[
Текст
]
Ссылки http://www.ffl.msu.ru/research/vestnik/2-2008-gorodetskaya.pdf -- 157.0 Кб -- 02.02.2013
[
Текст
]
Ссылки http://ffl.msu.ru/research/vestnik/2-2008-gorodetskaya.pdf -- 157.0 Кб -- 25.02.2013 Похожие документы
Nuclear Instruments and Methods in Physics Research B 150 (1999) 635±639 The combined application of PIXE analysis and thermoluminescence (TL) dating for elucidating the origin of iron manufacturing in Japan N. Hagihara a,* , S. Miono a, Z. Chengzhi a, Y. Nakayama b, K. Hanamoto b, S. Manabe c a Faculty of Science, Osaka City University, Osaka 558-8585, Japan b Ritsumeikan University, Kusatsu, Shiga, Japan c Committee of Education, Katano City, Osaka, ... Keywords: PIXE; TL dating 1. ...
... Выставка работ художника А. Астрина< . ... Перевод Т. С. Эллиота . ... Александр Коганов. Перевод У. Шекспира . ... Стрела времени" (.pdf, 114 Кб) . ... Об Институте . Положение об Институте . Лаборатории-кафедры Института . ... Электронный журнал "Феномен и ноумен времени" . ... Труды Института . ... Биографический справочник "Исследователи времени: история и современность" . Международное Общество по Изучению Времени . Зал дискуссий . Цитаты и афоризмы о времени . ...
... Each day a different image or photograph of our fascinating universe is featured, along with a brief explanation written by a professional astronomer. ... In the Center of 30 Doradus . ... Explanation: In the center of 30 Doradus lies a huge cluster of the largest, hottest, most massive stars known. The center of this cluster, known as R136 , is boxed in the upper right portion of the above picture. ... 30 Doradus and R136 lie in the LMC - a satellite galaxy to our own Milky Way Galaxy . ...
... Как работать с сервером . ... Администраторы сети кафедр . ... Почтовый сервер Химического факультета МГУ им. М.В.Ломоносова работает под управлением ОС Microsoft Windows 2008 Server и Microsoft Exchange Server 2007. ... Настроить для работы с сервером программу Microsoft Outlook Express либо любую другую почтовую программу, поддерживающую протоколы POP3 и / или IMAP4. ... Воспользоваться программой Microsoft Outlook , настроив ее на работу с Microsoft Exchange Server. ...