... Each of the nanodisks exhibits both electric and magnetic Mie-type resonances that are shown to affect significantly the nonlinear response. We observe the thirdharmonic radiation intensity that is comparable to that of a bulk silicon slab and demonstrate a pronounced reshaping of the third-harmonic spectra due to interference of the nonlinearly generated waves augmented by an interplay between the electric and the magnetic dipolar resonances. ...

Еще в разделе: (Показать все результаты (>56) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/apl97_261908_2010.pdf
• http://nanolab.phys.msu.ru/sites/default/files/apl94_231122_2009.pdf
• http://nanolab.phys.msu.ru/sites/default/files/jetplett103_46_2016.pdf

... Смирновский сборник" . Смирновские чтения" . ... The jubelee X Scientific Reading dedicated to Academician V.I. Smirnov was held January 29, 1999, in the Moscow State University (MGU). ... Diplomas and prizes of the Smirnov Foundation have been awarded to 37 prominent scientists of Russia, CIS and other countries, as well as 72 best under- and post- graduate students from different institutes and unversties of Russia. ... The programm of X Smirnov reading was highly interesting. ...

Еще в разделе: (Показать все результаты (>45) - www.geol.msu.ru/ )

• Экслибрис-книжный знак коллекция экслибрисов, collection of ex libris, собрание
• Faculty of Geology >> Geology at Moscow State University

... David Kirk/NVIDIA and Wen-mei W. Hwu , 2007-2012 ECE408/CS483, University of Illinois , Urbana-Champaign 14 CUDA Device Memory Management API functions · cudaMalloc() ­ Allocates object in the device global memory ­ Two parameters · Address of a pointer to the allocated object · Size of of allocated object in terms of bytes ( Device ) Grid Block (0, 0) Block (0, 1) Registers Registers Registers Registers · cudaFree() ­ Frees object from ...

Еще в разделе: (Показать все результаты (>3) - ccoe.msu.ru/ )

... 24 months to develop your career in Finance and Marketing Departments in British American Tobacco; . ... We are looking for high calibre graduates to join a truly FAST -TRACK Management Trainee Programme. ... In Russia, Management Trainee programme exists since 1996, so we have a great pool both of experienced coaches and successful programme graduates. ... You can also read more about Finance, Marketing functions, Management Trainee Program itself, Selection Process on this microsite. ...

Еще в разделе: (Показать все результаты (>60) - www.physcareer.ru/ )

• Software Requirements Analyst / Вакансии / Physcareer.ru
• Конкурс грантов для молодых исследователей National Geografic / Гранты и

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

• ConClus

The VLT Survey Telescope: a year after its coming into operation Massimo Capaccioli Department of Physics, University of Naples Federico II National Institute of Astrophysics - VST center at Naples The VLT Survey Telescope (VST) is a 2.6 m wide field optical telescope located at the Cerro Paranal Observatory of ESO in the Chilean Andes. ... The wide field is sampled by OmegaCam, a camera with a mosaic of 32 CCD for a total of 256 Mpixels, provided by the homonymous consortium. ...

Еще в разделе: (Показать все результаты (>13) - master.sai.msu.ru/ )

• SAI Space Monitoring Laboratory
• Ya.B. Zeldovich All-Moscow Seminar of Astrophysicists

... В.Е.Юрасова, Современные теории катодного распыления и микрорельеф распыляемой поверхности металла, ЖТФ, 1958, 28, ?9, 1966-1970. ... V.I.Shulga, I.G.Bunin, V.E.Yurasova, V.V.Andreev, B.M.Mamaev, Influence of surface semichannels on ion scattering by crystals, Phys. Lett., ... Рентгеновские, синхротронные и нейтронные исследования, 2000, ? ... Особенности распыления сплавов Ni-Pd с разным содержанием компонент, Поверхность - рентгеновские, синхротронные и нейтронные исследования, 2006, ?7, 13- 17. ...

Еще в разделе: (Показать все результаты (>3) - physelec.phys.msu.ru/ )

• http://physelec.phys.msu.ru/staff/zykovapubl.doc

Information Projects Detectors Staff Publications Contacts . ... Ahn H., Bashindzhagyan G.L., Kuznetsov E.N., Voronin A.G., et al ., ... April Meeting, Jointly Sponsored with the High Energy Astrophisics . Division (HEAD) of the American Astronomical Society, . April 20-23, Albuquerque , New Mexico , USA , Abstracts, . 2002, p . ... Gunasingha R., Bashindzhagyan G.L., Kuznetsov E.N., Voronin A.G., . ...

Еще в разделе: (Показать все результаты (>3) - silab.sinp.msu.ru/ )

этой страничке помещены некоторые интернет-адреса, где можно посмотреть на фотографии лишайников , прочитать о лишайниках и лихенологах, а также, найти ссылки на другие лихенологические интернет-ресурсы. http ://www. lichen .com - NORTH AMERICAN LICHEN PROJECT ( фотографии лишайников ). http ://www.sbg.ac.at/pfl/projects/ lichen /index.htm - Lichen Information System (информационная система) ...

Еще в разделе: (Показать все результаты (>26) - www.ecocoop.ru/ )

... Journals . Memoirs of the Faculty of Physics . Moscow University Physics Bulletin . ... The conference papers from the School-Seminar ?Waves-2014? will be submitted for publishing in the Memoirs of the Faculty of Physics journal. ... Moscow University Physics Bulletin was founded in 1946 by Lomonosov Moscow State University and the Faculty of Physics. ... World-known physicists working at the Faculty of Physics (including 8 Nobel laureates) used to be and are the authors of the journal. ...

154. ITPM MSU Quantum Computing Page