... Faculty . ... Scientific laboratories . ... ternarycomp.cmc.msu.ru . ... 119991, Moscow, GSP-1, Leninskiye Gory, MSU, 2nd Educational Building, CMC Faculty, rooms 743, 744, 749, 750 (Head of the laboratory), 777, 778 . The Laboratory was created in 1958 initially in the Department of Computational Mathematics of the Faculty of Mechanics and Mathematics (MSU). ... The unique ternary computers "Setun" (1958) and "Setun 70" (1970), still unmatched in the world were created by the Laboratoryт??s team. ...
... Квантовая теория . ... Непертурбативная низкоэнергетическая физика адронов и лептонов (руководители - проф. К.А.Свешников, проф. А.Е.Дорохов). ... Методы квантовой теории поля в физике конденсированного состояния (руководители - с.н.с. О.В.Павловский, с.н.с. М.В.Улыбышев). Кафедра активно участвует в организации и проведении ежегодных международных семинаров по проблемам квантовой теории поля и теории гравитации в ИФВЭ - Протвино. ... Phys. Rev. D 85 (2012) 094022, arXiv: 1110.6059. ...
... Graduated from M.Lomonosov Moscow State University, Department of Mechanics and Mathematics. Dissertation's title of Ph.D. (Phys.& Math): "Aerodynamic Characteristics, Shape-Formation and Stressed-Strained State of Parachute Canopy." ... Graduated from M.Lomonosov Moscow State University, Piano Class. ... Development of mathematical models and parameter computation methods for the shape, aerodynamic drag and stressed-strained state of parachutes with different canopy geometry. ...
О кафедре . ... Научные работы . ... Кафедра механики композитов . ... Традиционная выездная зимняя Школа-Конференция кафедры механики композитов в Подмосковном пансионате "Университетский" под Звенигородом. 2010 год. 2009 год. 2008 год. Ежегодная конференция Ломоносовские чтения. 2011 год. 2010 год. 2009 год. ... Математика. ... Механика твердого тела " студентов и аспирантов кафедры механики композитов за последние 3 года в обратном хронологическом порядке. ... Моск. ун-та. ... Механика. ...
... Nonlinear optics of ionized mediums . Fiber lasers . ... Emergence of powerful laser systems, being able to deliver powerful ultrashort light pulses, allows one to investigate and exploit new class of nonlinear-optical phenomena, based on the media ionization, when the electrons are released by strong electromagnetic field directly or by collision of an atom with another electron accelerated in the field. ... Ultrafast optical switching of an ionized medium by interfering ultrashort laser pulses. ...
... Data . ... Planetary perturbations during geomagnetic storms are measured by the Dst index, which is the deviation of variation of the magnetic field from the undisturbed level, averaged over the values measured at the control chain of magnetic stations located in the low latitudes. ... To predict the hourly values of the Dst index, artificial neural networks (ANN) of perceptron type are used. ... Loading of the data on the values of the Dst index and forecast update are performed twice per hour. ...
... UHECR SINP MSU . ... TUS . ... mini-EUSO (UV atmosphere) . News . UHECR news . TLE news . Lab's news . Publications . Publications UHECR . ... For students . Our students . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . JEM-EUSO Extreme Universe Space Observatory on the Japanese Experiment Module (JEM) of the International Space Station . ... JEM-EUSO is a new type of observatory that uses the earth's atmosphere as a detector. ...
... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...
... Work of a system constructing the exercises with the help of a teacher is described. Algorithms of fragmentation of sound data into phonemes and of analysis of correctness of pronunciation of a student are suggested. ... The authors offer the functioning variant of a system, making it possible to a student to appreciate objectively a degree of correctness of his pronunciation, to classify errors and to listen to a difference of pronunciations of incorrect sounds interactively. ...
THE SECOND ANNUAL STUDENTS SCIENTIFIC CONFERENCE ON TODAYS' TOPICAL POLITICAL AND PHILOSOPHICAL USSUES Panel of political science HUMANISM IN POLITICS Chekalova Maria The faculty of political science Course 1 In my report I would like to talk about the relations between politics and humanism. ... Can politics be moral? ... NATIONALISM IN THE MODERN WORLD Huseinova Anna The faculty of political science Course 1 Today the question of nationalism is in the focus of intent public attention. ...
[
Текст
]
Ссылки http://www.ffl.msu.ru/faculty/departments/english-for-humanities/activities-of-the-department/abstracts-politologia.pdf -- 333.3 Кб -- 25.05.2013
[
Текст
]
Ссылки http://ffl.msu.ru/faculty/departments/english-for-humanities/activities-of-the-department/abstracts-politologia.pdf -- 333.3 Кб -- 25.05.2013 Похожие документы
Home Search Collections Journals About Contact us My IOPscience Intracavity generation of broadband biphotons in a thin crystal This content has been downloaded from IOPscience. ... 2013 Laser Phys. Lett. 10 045203 (http://iopscience.iop.org/1612-202X/10/4/045203) View the table of contents for this issue, or go to the journal homepage for more Download details: IP Address: 93.180.54.115 This content was downloaded on 02/10/2013 at 15:36 Please note that terms and conditions apply. ... Phys. Lett. ...
[
Текст
]
Ссылки http://qi.phys.msu.ru/papers/2013-lasphyslett-10-045203.pdf -- 388.9 Кб -- 02.10.2013 Похожие документы
... SDPpred is a tool for prediction of residues in protein sequences that determine functional differences between proteins, having same general biochemical function. ... Amino acid residues that determine differences in protein functional specificity and account for correct recognition of interaction partners, are usually thought to correspond to those positions of a protein multiple alignment, where the distribution of amino acids is closely associated with grouping of proteins by specificity. ...
... 53, Moscow, 117924 Russia *e-mail: grishan@comsim1.phys.msu.su **e-mail: zadkov@comsim1.phys.msu.su Received August 30, 2002 Abstract-- universal theory for calculating coherent population trapping resonances in multilevel atoms is suggested. ... Numerical simulation of coherent population trapping resonances shows that the open character of the system decreases the contrast of resonance curves in absorption spectra without changing resonance widths. ...
[
Текст
]
Ссылки http://qilab.phys.msu.ru/papers/jetp-96(4)-2003-preprint-en.pdf -- 986.4 Кб -- 04.02.2008 Похожие документы
... Unit I. Geologic Hazards and Man Unit II. ... Amazing Earth. ... Трансформируйте словосочетания в предложения. 1. geologic processes going on for millions of years 2. any geologic process can become a geologic hazard 3. some geologic hazards having resulted in disaster 4. many geologic hazards have affected the activity of man 5. a lot of earthquakes resulting in landslides 6. some naturally occurring hazards 7. many disasters are caused by geologic hazards 8. some ...
[
Текст
]
Ссылки http://www.geol.msu.ru/obsh/uch_ch2.doc -- 389.0 Кб -- 08.04.2016
[
Текст
]
Ссылки http://geol.msu.ru/obsh/uch_ch2.doc -- 389.0 Кб -- 08.04.2016 Похожие документы
... Laboratory of Problems for Magnetism, . ... Study of the magnetic and transport properties of R-3d intermetallic compounds with a magnetic instability of the itinerant-electron subsystem. ... const at high temperatures (Curie-Weiss law) [A.S. Markosyan, Y. Hosokoshi, K. Inoue, Phys. Lett. ... Gaidukova, Y. Hosokoshi, K. Inoue, A.S. Markosyan , Magnetic phase diagram and pressure effect on the magnetic properties of the Y 1? x Gd x Mn 2 intermetallic compounds, J. Phys.: Condens. ...
... Полная версия: Технические работы на сервере . Грация-МГУ::Форум > Общение > Другая жизнь . ... Apr 14 2011, 00:01 . ... сегодня весь день на сервере будут проводиться технические работы. ... Subject: Internet cleaning.....very important.. ... hours in order to allow us to clean it. ... Internet. ... Internet users has grown dramatically. ... to other sysops and Internet users as well. ... Internet users has grown dramatically. вопщем, очистка интырнетов это прекрастно во всех отношениях, ящитаю . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Ролан Барт . ... Первый Всемирный конгресс моющих средств (Париж, 1954) возымел эффект, который заставил весь мир поддаться эйфории от ' Омо ': детергенты не только не раздражают кожу, но возможно они даже способны избавить шахтеров от силикоза. ... Полезно было бы сравнить психоанализ отбеливателей (хлорированных, например) с психоанализом мыльных порошков ('Люкс', ' Персил ') или детергентов (' Омо '). ... Барт Р. (1998). Мыльные порошки и детергенты (из книги "Мифологии") . ...
... Phys. A25 (2010) 3933 (arXiv:0908.0457 [hep-ph]) A brief reminder AdS/CFT correspondence the conjectured equivalence between a string theory defined on one space and a CFT without gravity defined on conformal boundary of this space. ... At one imposes certain gauge invariant boundary conditions on the fields. Equation of motion for the scalar field Solution independent of usual 4 space-time coordinates where M is identified with the quark mass matrix and with the condensate. ...
... Gas evolution from Brazilian rock crystal and quartz as raw materials for producing silica glass . ... Gas content, along with the content of element impurities and the content of mineral inclusions, is one of the most important characteristics of quality for quartz raw materials in producing high-quality silica glass. Gas evolution from rock crystal and vein quartz from Brazil as quartz raw materials for producing high-quality silica glass has been studied. ...