. Rolling Simplexes and their Commensurability. (Axiom and Criterion of Incompressibility, Momentum Lemma) / Razmyslov Yu.P. // Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. 2011. ? 5. P. 55-58 [Moscow Univ. Math. Bulletin. Vol. 66, N 5, 2011.]. The total geometrical theory of field is recreated. Key words : projective plane, affine chart, rolling, incompressibility, desargues condition, field. ? 5/2011 . Toggle formulas format . (LaTeX / SVG)

Еще в разделе: (Показать все результаты (>85) - vestnik.math.msu.su/ )

... Выпускники . ... Женский клуб . ... Издательство МГУ . ... Выпускники МГУ . ... Дайв-Клуб МГУ . ... Секрет - новые, технологически "умные" таблетки. ... По размеру таблетка-чип не превышает песчинку. ... According to the pill's manufacturer, the "sensor" can monitor when drugs are taken, how much dosage should be administered while at the same time monitoring a patient's heart rate and body temperature. ... Smart' cancer pill on NHS 28 May 2003 . Smart' pill eases twin nicotine urges 14 Sep 2000 . ...

Еще в разделе: (Показать все результаты (>449) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: КИБЕРНЕТИЧЕСКАЯ ЛИЧНОСТЬ. БЕССМЕРТИЕ?
• Клуб выпускников МГУ: Современные устройства магниторезонансной терапии и
• Клуб выпускников МГУ: Обратить седину вспять

... Alexei Lidov.. ... The creation of sacred space as a form of creativity and subject of cultural history .. ... 91 Mikhail V. Bibikov Byzantine Eden: "time in space" .. ... 140 Svetlana Popovi The Byzantine Monastery: its Spatial Iconography and the Question of Sacredness .. ... 525 762 Milena Rozhdestvenskaya The Creation of Sacred Space in Medieval Russian Literature: apocrypha and chronicles .. ... 556 Vladimir V. Sedov The Sacred Space of the Medieval Russian Church: the Architectural Aspect .. ...

Еще в разделе: (Показать все результаты (>19) - imk.msu.ru/ )

• Институт мировой культуры МГУ

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

... Полная версия этой страницы: Software Developer . Студенческий форум Физфака МГУ > Общий > Работа . Anastasiya . ... BroadVision QuickSilver enables you to create and publish lengthy, complex documents in multiple output formats (including HTML, PDF and Postscript) and automates publishing of personalized content to BroadVision Portal. Assemble publications from a variety of text, graphic and database sources, including Microsoft Word, AutoCad, Microsoft Excel, and Oracle. ...

Еще в разделе: (Показать все результаты (>468) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > Вакансии от компании Antz
• Студенческий форум Физфака МГУ > Работа в Samsung
• Студенческий форум Физфака МГУ > Оптические иллюзии

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>6) - sinp.msu.ru/ )

... Keywords: mass media, media industry, media psychology, media audience, homo mediatis Having become an essential part of the modern economy in the postindustrial world, the media have inevitably also become one of the most profitable and powerful industries.Their political, social, and cultural nature is directly influenced by entrepreneurial activity and the market laws of supply and demand (Albarran, 2010). ... Modern people "check" a considerable portion of their political decisions with the...

Еще в разделе: (Показать все результаты (>169) - www.psy.msu.ru/ )

• http://www.psy.msu.ru/science/psyrussia/2013-3/2013_3_49-59.pdf
• http://www.psy.msu.ru/science/psyrussia/2013-3/2013_3_4-18.pdf
• http://www.psy.msu.ru/people/krivitsky/krivitsky2007.pdf

... Лекторий по физике . ... Главная / О факультете / Подразделения факультета / Отделения и кафедры / Кафедра компьютерных методов в физике . ... Методы анализа и интерпретации эксперимента . Математические методы анализа и интерпретации эксперимента разрабатывались на кафедре под руководством проф. Пытьева Ю.П. более 25 лет. ... Методы позволяют эффективно учитывать симметрию решаемой задачи анализа и интерпретации, а также трудно формализуемые сведения о моделируемых объектах и явлениях. ...

Еще в разделе: (Показать все результаты (>179) - phys.msu.ru/ )

• Title
• Faculty today

The 3 rd Autumn forum of volunteers in MGU. Last weekend the chemical faculty of MGU held the Autumn forum of volunteers from Russian organization "World4U". The university students and visitors from abroad discussed actual problems of science and life. ... Lectures after V. Vinogradov to be read at the philological department. ... Students of historical department of the Moscow State University are thinking over the possibility to create a Museum of substitutes for modern money. ...

Еще в разделе: (Показать все результаты (>17) - www.rlcentre.com/ )

... Electronic journal Issue 4. 10 september 2004 Leigh E. Making Learning a Game Introduction. As a university lecturer I enjoy playing games with learning goals in mind. My students are all adults who work in many different roles. ... Their needs include learning how to design activities that will support acquisition of practical skills, extend personal understanding of emotional factors, and improve awareness of factors ­ such as economic, ecological and political aspects of society. ... Play. ...

Еще в разделе: (Показать все результаты (>14) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./paliulis_chlivickas.pdf

... News . For 1st and 2nd-year students . Introduction to quantum physics . ... About us . ... Create new account (active tab) . ... Request new password . E-mail * . A valid e-mail address. All e-mails from the system will be sent to this address. The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. Create new account . ... 2003 2016 Department of Quantum Electronics . ...

Еще в разделе: (Показать все результаты (>5) - quantum.phys.msu.ru/ )

... Государственный Астрономический Институт имени П.К. Штернберга МГУ . ... Семинары ГАИШ . ... Государственный астрономический институт им. П.К.Штернберга (ГАИШ) научно-исследовательский институт, являющийся одним из подразделений МГУ им. М.В. Ломоносова . ... 11 декабря 2006 года исполнилось 175 лет со дня создания на Пресне Астрономической обсерватории Московского университета, ставшей впоследствии базой для формирования Государственного астрономического института им. П.К. Штернберга (ГАИШ МГУ). ...

Еще в разделе: (Показать все результаты (>124) - sai.msu.ru/ )

• А С Т Р О К У Р Ь Е Р
• Конференции сайта АстрО
• Future Prospects of Variable-Star Catalogues

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>16) - npidb.belozersky.msu.ru/ )

• NPIDB: 5DPK structure

... about ERC . education . research . events . ... Being an effective way of acquiring knowledge, they also make a good addition to core lecture courses and involve students, postgraduates and scientists of other Russian higher education institutions and research centers in ERC activity in the initial stage. ... More information can be found at http://polly.phys.msu.ru/ru/unc/sconf.html . ... Conference on Development Prospects of Education and Research Centers in the Russian Federation . ...

Еще в разделе: (Показать все результаты (>31) - nano.msu.ru/ )

• International School ?Computer simulation of advanced materials?, 16?21 July
• Registration for the International School ?Computer simulation of advanced

Московский государственный университет имени М.В.Ломоносова Основан в 1755 году . Нормативные документы МГУ . Правила приема в МГУ в 2016 году . Дополнение к правилам приема в МГУ имени М.В.Ломоносова в 2016 году для лиц, проживающих в Крыму . ... Перечень иностранных языков, по которым проводится вступительное испытание по иностранному языку при приеме на первый курс на обучение по программам магистратуры в МГУ имени М.В.Ломоносова в 2016 году . ... центральной приемной комиссии, . ...

156. http://imaging.cs.msu.ru/files/courses/ipintro2012/Lec_Pt2_MATLAB_Workshop_SHORT.pdf

157. MSU Chamber Orchestra. Hystory.

158. YaB-100 - Homepage

159. http://www.edst.msu.ru/conf/docs/USA-2002%2B.doc

160. Master program "Open Information Systems" | Магистерское и послевузовское