. Обнаружена попытка некорректного доступа. Этот сервер доступен только по адресу "http://distant.phys.msu.ru". Пожалуйста, сообщите об этом администратору сервера. Эта страница автоматического перенаправления. Если ничего не происходит, воспользуйтесь указанной ниже ссылкой "продолжить". Продолжить
... Earth plasma sheet quite rapidly in the form of kinetic energy of the earthward ~owing ions[ Braking of these BBFs results in the ~ow of the electric currents associated with the substorm current wedge cf Shiokawa et al[\ 0886^ Slavin et al[\ 0886#[ In order to provide su.cient energy for the substorm process in the near ! Earth plasma sheet\ a signi_cant volume of the center of the magneto! tail must be _lled with BBFs[ Future multi!satellite studies in ...
... Electronic journal Issue 4. 10 september 2004 Briedis V. Pareto Structures A great Italian economist Vilfredo Pareto (1848 1923) in his unique economics and sociology studies [1, 2] continuously emphasised the systematic approach, reviewing the society development problems. ... Formal model of Pareto Structure First of all, provide a formal mathematical model adequately featuring the Pareto Structure. ... Indeed, I was primarily interested in the classical (harmonic structure) model at s = 1. ...
[
Текст
]
Ссылки http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./briedis.pdf -- 388.0 Кб -- 06.07.2014 Похожие документы
... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...
The most up-to-date information related to atmos 3.0 are collected here due to constantly increasing interest to MASS/DIMM processing software... atmos 3.0 is still beta , so the latest version is 2.97.5 (there is also 2.98.x branch which absorbs new features) . ... M' line: . ... free seeing and its relative error . ... dimm seeing and its relative error (if dimm data are present, zeros otherwise) . ... dimm turbulence power and its relative error (if dimm data are present, zeros otherwise) . ...
2011 год . ... 2010 год . ... Известия РАН, Серия физическая, 2010, т. 74, ?10, с. 1441-1443. С.А.Вызулин, Е.В. Лебедева, Д.А. Лысак, Н.Е.Сырьев. ... Известия РАН, Серия физическая, 2010, т. 74, ?10, с. 1767-1769. ... Известия РАН, Серия физическая, 2010, т. 74, ?10, с. 1721-1723. ... 2009 год . ... В.Е. Буравцова, Е.А. Ганьшина, А.А. Дмитриев, О.С. Иванова, Ю.Е. Калинин, А.В. Ситников Известия Академии Наук, серия физическая, Т73, ?9, с. 1374-1376 (2009). _______________________________ . ...
A. Gardziella, L. A. Pilato, A. Knop . ... The technical content of the book describes significant new phenolic resin chemistry, transformations and recent mechanistic pathways of resole and novolak cure. ... Also included in detail: Standardized test methods important for ISO 9001 ff certification. книга " Phenolic Resins: Chemistry, Applications, Standardization, Safety, and Ecology " . ...
ЛАБОРАТОРИЯ ХИМИИ И ФИЗИКИ ПОЛУПРОВОДНИКОВЫХ И СЕНСОРНЫХ МАТЕРИАЛОВ . ... dots // Journal of Alloys and Compounds, 582, (2014), 43-49. web-design: ddirin@rambler.ru . 2008-2014 Лаборатория химии и физики полупроводниковых и сенсорных материалов. ...
... Форумы > Разное > Тема . ... Форумы Список тем Новая тема . 13.10.2012 21:27 . ... Международная интернет олимпиада по финансам "ФинОлимп 2012" . ... Приглашаем принть участие в интернет олимпиада по финансам ФинОлимп 2012 с призовым фондом 320 000 рублей. Организаторы PFL Portfolio Management . ... ФинОлимп - это... - самая технологичная Олимпиада в мире по финансам . ... Последний 13.10.2012 21:29. ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...
... МГУ имени М.В. Ломоносова проведет конференцию 'Социальные лифты для талантливой молодежи - лучший российский опыт' . МГУ имени М.В. Ломоносова, 14 июня, совместно с АФК 'Система' в партнерстве с газетой 'Ведомости' проведут конференцию 'Социальные лифты для талантливой молодежи - лучший российский опыт' (http://www.vedomosti.ru/feature/lift2012/newsline/4303), которая откроет цикл ежегодных экспертных обсуждений по данной теме. ... 2003 2011 MsuNews.Ru Новости МГУ . ... Экспорт новостей (RSS) ...
... Chem. ... 28] A. D. Ryabov Figure 2. a) Steady-state rate of HRP-catalyzed oxidation of (R,S)-1 as a function of pH : [1] 8 б 10ю4 m , [H2O2] 2 б 10ю4 m , [HRP] 10ю7 m, 25 8C. b) Effects of pH on the HRP enantioselectivity in terms of kR/kS ratio for HRP-catalyzed oxidation of 1 versus solution pH : [H2O2] 2 б 10ю4 m , [HRP] 10ю7 m, 25 8C. HPR-catalyzed oxidation of (R)- and (S)-1 by H2O2 : Compound 1 is soluble in water at pH b 6, that is, when the acid is deprotonated.[ ... 5 Figure 1. ...
... The circular sidewall of the layer was made of plexiglass. ... This is in contrast to the situation of horizontal layer where longitudinal magnetic field doesn't influence on convective instability and only renders oriented effect [8,10]. [ pic ] Figure 6 Stability boundaries of thermally driven shear flow in an inclined ferrofluid layer in the presence of a longitudinal magnetic field : a - shear flow ; b - convection rolls aligned with the shear flow ; c - convection ...
... Geography of World Economy . ... Field stations . ... Type of field courses . ... Khibiny station . ... Arkhangelsk station . ... The Arkhangelsk (Ustiayansk) research and training field environmental station is located in Ustiayanskyi district of the Arkhangelsk Region in the interfluve area of Vaga and Northern Dvina rivers. ... Emelianova L.G., Goriayinova I.N., Miaylo E.G. The Life of Taiga (Ecological Excursions in Ustiayanskyi district of the Arkhangelsk Region) M., Arkhangelsk. 1999. 162 pp. ...
... 12, 43 44 (2012) / DOI 10.1002/pamm.201210013 Cases of Complete Integrability in Transcendental Functions in Dynamics and Certain Invariant Indices Maxim V. Shamolin1, 1 Institute of Mechanics, Lomonosov Moscow State University, Michurinskii Ave., 1, 119899 Moscow, Russian Federation The results of this work appeared in the process of studying a certain problem on the rigid body motion in a medium with resistance, where we needed to deal with first integrals having nonstandard properties. ...
Параметры для задания некоторых индивидуальных атрибутов элемента слоя <common key params> . Эти параметры задаются при описании каждого элемента слоя . Одинаковые для всех элементов слоя ключевые параметры - <common key params> . позволяют задать ряд общих свойств элементов слоя: . ... идентификатор элемента слоя - положительное целое число . ... на выбранном элементе активного слоя (если параметр не задан, то . используется индивидуальный URL элемента слоя) . ...
... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Executive MBA programs have kept their popularity among high-ranking businesspeople in Russia, despite the economic crisis. ... The Chicago School of Business created the first EMBA program in 1943, and more than 300 programs now exist worldwide, according to the Executive MBA Council, an international business education association. ... Even when the EMBA program uses the same business cases as the MBA offering, Boltrukevich said, the education s different because the group of students is different...
THE RUSSIAN STYLE OF CIVIL PROCEDURE Dmitry Maleshin Reprinted from Emory International Law Review Volume 21, No. ... 26 See id. ... Another exceptional feature of the Russian civil procedure is the original status of judicial precedent as a source of Russian civil procedural law. ... 98 See OSCAR G. CHASE, LAW , CULTURE, AND RITUAL: DISPUTING SYSTEMS IN CROSS-CULTURAL CONTEXT 53-55 (2005); JAMES ET AL., supra note 6, at 309-10; THOMAS MAIN, GLOBAL ISSUES IN CIVIL PROCEDURE 5 (2006); Oscar G. Chase. ...