... Radical changes in the life of the country at the end of the twentieth century put the Moscow University within the need of maintaining a high level of classical university education in the new environment. ... In June 2006 the Academic Council of the Moscow State University has decided to establish a new Faculty - Higher School of Management and Innovation (Corporate University) - jointly with JSFC "Sistema" . ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>28) - hsmi.msu.ru/ )

• School overview | MSU Higher school of management and innovation
• MSU Higher school of management and innovation |
• Application for participation | MSU Higher school of management and innovation

Host: localhost Database: atomax2 --------------------------------------------------------- -- Server version 3.23.52-nt -- -- Table structure for table ' deliveries ' -- DROP TABLE IF EXISTS deliveries ; CREATE TABLE deliveries ( id_delivery int (11) NOT NULL auto_increment, subj varchar( 255 ) default NULL , author varchar( 255 ) default NULL , type tinyint (4) default ...

Еще в разделе: (Показать все результаты (>8) - textbook.sinp.msu.ru/ )

• SPAW Editor documentation

T.V. Tyupikova, V.N. Samoilov The automated networks of management of financial activity, the control and the account of databases of economic divisions Joint Institute for Nuclear Research. ... Now let's consider concepts "an elementary object" and "a conditional unit of the information" with reference to systems of the analysis and management of the financial and economic activity of anthe enterprise. ... The address part of the elementary object is the number of the account (or of the subaccounts). ...

Еще в разделе: (Показать все результаты (>45) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/huhlaev/Metamake.doc
• http://acat02.sinp.msu.ru/presentations/kodolova/acat.pdf
• http://acat02.sinp.msu.ru/presentations/ratnikova/01.pdf

... Living systems depository "Noah's Ark" . ... About the project . ... The project of the Moscow State University "Noah's Ark" is dedicated to the creation of multi-functional network storage of biological material. ... Creation of temporary prototypes of living systems depository bank for storage and research of the collected material. ... Development of algorithms for the information processes analysis in living systems for receiving, filing and processing of various types of biological data. ...

Еще в разделе: (Показать все результаты (>6) - depository.msu.ru/ )

• Biological information | depozitariy
• Main grant | depozitariy

... ОТЧЕТЫ СТУДЕНТОВ О ПРАКТИКЕ В САО . Лето 2001 года . ... Гришатовой Юлии . ... Для определения лучевых скоростей, FWHM (полной ширины на половине максимума) и интенсивности линия He I 6678.15А описывалась гауссианой ( рис.1 ). ... create/icat {P1} ztsh*.bdf . execute/catalog @@ set_lambda {P2} . execute/catalog @@ timing {P2} . execute/catalog @@ phase {P2} . ... create/table {P1}.tbl . ... create/column {P1}.tbl fwhm . execute/catalog @@ add_rv_curve_point {P2} {P1}.tbl . ...

Еще в разделе: (Показать все результаты (>18) - heritage.sai.msu.ru/ )

... Программы обучения . ... Пропустить категории курсов . ... Пропустить новости . ... от Администратор ЦДО Ф/Ф МГУ - Понедельник 4 Август 2014, 09:53 . 04 августа 2014 года в Интеллектуальном центре ? ... Российские ВУЗы все чаще переходят на дистанционное обучение . ... ДИСТАНЦИОННЫЕ ПОДГОТОВИТЕЛЬНЫЕ КУРСЫ ФИЗИЧЕСКОГО ФАКУЛЬТЕТА МГУ ПО ФИЗИКЕ И МАТЕМАТИКЕ Пропустить Страницы ЦДО в социальных сетях . ... Центр дистанционного образвания физического факультета МГУ им. М.В. Ломоносова 2007-2012 . ...

Еще в разделе: (Показать все результаты (>53549) - distant.phys.msu.ru/ )

• Уведомление

... Магистерское образование . ... Магистерские программы . ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Open Information systems? and ?Network software?. ... Are researched the most frequently used applied protocols of net security and protocol of creating virtual private nets. ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Program devices of net?. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>7) - hcs.cmc.msu.ru/ )

... Download NPG-explorer . ... Build nucleotide pangenome . ... Here we provide a table for 3 Brucella genomes: all: embl :CP002459 BRUMM chr1 c Brucella melitensis M28 chromosome 1 all: embl :CP002460 BRUMM chr2 c Brucella melitensis M28 chromosome 2 all: embl :CP003176 BRUAO chr1 c Brucella abortus A13334 chromosome 1 all: embl :CP003177 BRUAO chr2 c Brucella abortus A13334 chromosome 2 all: embl :CP002078 BRUPB chr1 c Brucella pinnipedialis B2/94 chromosome 1 all: ... Fix bugs....

Еще в разделе: (Показать все результаты (>2) - mouse.belozersky.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

Particle pair production in strong EM field, Imaginary temperature and field emission Boris Levchenko SINP MSU, Moscow Tunneling processes (Nature, adv. technologies) Electron field emission from metals: quantum theory by Fowler and Nordheim Results by Sauter and Schwinger for electric field in vacuum Condensed matter .vs. ... QFTHEP'10, BB Levchenko Pair production 16 Scheme of probing strong-field QED in the collisions of a 50-GeV electron beam with a focused laser beam. ...

Еще в разделе: (Показать все результаты (>80) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2011/anomalous_wtb_qfthep11.pdf
• http://qfthep.sinp.msu.ru/talks2013/POZDEEVAQFTHEP13.pdf
• http://qfthep.sinp.msu.ru/talks/QFTHEP2010_leonidov.pdf

Given word length and max number of mismatches . Use MEME algorithm for define conserved blocks . Apply the Dynamic programming algorithm to create chain of the blocks . Refine the chain using combined profile for chain of blocks. ... Reduce word length and number of mismatches and repeat the procedure for spacer between the blocks. ... Create helix profile and apply MEME-like iterative procedure to find sets of helices that consistent lokated reative to conserved blocks . ...

Еще в разделе: (Показать все результаты (>3) - bioinf.fbb.msu.ru/ )

... MSU Chamber Orchestra . ... Chamber Orchestra of Moscow State University was born in 1967. ... It was originally formed as a chamber orchestra at the School of Mathematics and Mechanics but soon (since September 1967) transformed into a Chamber Orchestra of the Moscow State University. ... The Chamber Orchestra of Moscow State University won the first prizes in the 1-st and 2-nd All-Union festivals of non-professional arts. ... Moscow State University does not have its own School of Music. ...

Еще в разделе: (Показать все результаты (>73) - music.genebee.msu.ru/ )

VARIABLE STARS, THE GALACTIC HALO AND GALAXY FORMATION C. Sterken, N. Samus and L. Szabados (Eds.) 2010 Formation Mechanisms for Spheroidal Stellar Systems O. K. Sil'chenko 1 Sternberg Astronomical Institute of the Moscow State University, Moscow, Russia Abstract. Spheroidal stellar systems on various scales include elliptical galaxies, dwarf spheroidal galaxies, and globular stellar clusters. ... The formation mechanisms of the oldest globular clusters represent a puzzle yet. ... 2009). ...

Еще в разделе: (Показать все результаты (>50) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/ic3653.pdf
• Olga Silchenko

... Chair of Computer Methods of Physics . Department of Physics, M.V. Lomonosov Moscow State University . Create new account . ... Request new password . Username * . Enter your Chair of Computer Methods of Physics username. Password * . Enter the password that accompanies your username. ... Department of Physics M.V. Lomonosov Moscow State University , Chair of Computer Methods of Physics , 2014 . ... Let us know ! ...

Еще в разделе: (Показать все результаты (>3) - cmp.phys.msu.ru/ )

... Laboratory "Сryoelectronics" . Currently our group is working atљ experimental љstudying of nanoelectronic devices based on silicon, mostlyљsilicon nanowires and single-electron transistors. ... Suspended single-electron transistor made up from highly doped silicon on insulator (Laboratory of Cryoelectronics 2012)љ . ... E: This email address is being protected from spambots. You need JavaScript enabled to view it. P: +7 (495) 939-39-87 . ... 2016 Laboratory "Сryoelectronics" ...

Еще в разделе: (Показать все результаты (>10) - cryolab.phys.msu.ru/ )

• Molecular single-electronics
• Alexandr A. Parshintsev

О лаборатории . ... Лаборатория теоретической биофизики . ... This Python module parses Gaussian cube files, produced by quite a few QM software packages, and makes volume data available as numpy array as well as some associated properties. ... Нет комментариев " Gaussian Cube files loader " . ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>10) - erg.biophys.msu.ru/ )

• Lipid membrane MD modeling with GROMACS ERG Research Group: Лаборатория
• membrane ERG Research Group: Лаборатория теоретической биофизики

Open Conference Systems . Conference Help . ... Username . Password . Remember me . ... Conference Content Search . All Authors Title Abstract Index terms Full Text . ... By Conference . By Author . By Title . ... For Authors . Home . ... Log In . Account . Search . Current Conferences . Home > Log In . ... Remember my username and password . ... Create an account with this site . Forgot your password? ...

Еще в разделе: (Показать все результаты (>39) - hea.phys.msu.su/ )

• Account

. Russian Version . Faculty of Computational Mathematics and Cybernetics . The Department of Operations Research . About Us . News . ORM2016: actual announcement and abstract templates . Archive of . Conferences ORM . Study . Undergraduates . Postgraduate education . Bachelor Program . Master Program . Faculty . Lecture . notes . Contacts . Graduates . New . publications . Create Date : 23.05.05 . The Department of Operations Research

Еще в разделе: (Показать все результаты (>13) - io.cmc.msu.ru/ )

• Кафедра Исследования Операций

... The Department of Operations Research . April 9, 2016 . Welcome Traditional topics of the conference Important dates Abstracts Registration . Final program Accommodation Program committee Organizing committee . ... V Moscow International Conference . on Operations Research, . ... Moscow, April 10-14, 2007 Final program . ...

Еще в разделе: (Показать все результаты (>10) - io.cs.msu.ru/ )

... about ERC . education . research . events . ... Being an effective way of acquiring knowledge, they also make a good addition to core lecture courses and involve students, postgraduates and scientists of other Russian higher education institutions and research centers in ERC activity in the initial stage. ... More information can be found at http://polly.phys.msu.ru/ru/unc/sconf.html . ... Conference on Development Prospects of Education and Research Centers in the Russian Federation . ...

Еще в разделе: (Показать все результаты (>10) - nano.msu.ru/ )