... Публикации 2015 года . ... 2563496, 25 августа 2015 г. Тезисы докладов: . ... Москва: ЦИАМ им. П. И. Баранова, 2015. ... Волны в вязкоупругом слое, расположенном под слоем движущейся жидкости // Тезисы докладов VIII международной конференции 'Лаврентьевские чтения по математике, механике и физике'. ... Публикации 2014 года . ... Секция механики. 14 - 23 апреля 2014, Москва, МГУ имени М. В. Ломоносова. ... Публикации 2013 года . ... Секция механики. 15-23 апреля 2013, Москва, МГУ имени М.В.Ломоносова...
... Seminar archive . ... Seminar archive 2013 6 September . ... Амстердам, 29-30 августа 2013) . ... Потерянная темная материя в Местной Вселенной . ... Липунов В. М. Download presentation . ... рассмотрены особенности распределения светлой (звездной) и темной материи . ... Средняя плотность материи в этом объеме, . ... б) местный объем Вселенной не является репрезентативным, будучи . ... в) основная доля материи во Вселенной не связана со скоплениями и . ... проблема потерянной темной материи. ...
... АНАТОЛИЙ ТИМОФЕЕВИЧ ТЕРЕХИН ANATOLY TEREKHIN (TERIOKHIN) . ... Будилова Е.В., Терехин А.Т. Математическое моделирование эволюции жизненного цикла: краткая история и основные направления// Журнал общей биологии, 2010. ... Ponton F., Duneau D., S?nchez M., Courtiol, A., Terekhin A.T., Budilova E.V., Renaud F., Thomas F. Effect of parasite-induced behavioral alterations on juvenile development. ... Терехин А.Т., Будилова Е.В. , Понтон Ф., Дюно Д., Санчес М., Мур Дж., ... Терехин А.Т., Будилова Е.В . ...
... Квантовая теория . ... КВАНТОВАЯ ТЕОРИЯ ПОЛЯ [7-й-8-й семестры] (проф. СЛАВНОВ Д.А.) . ... СОВРЕМЕННЫЕ ТЕОРЕТИЧЕСКИЕ ПРОБЛЕМЫ ФИЗИКИ ВЫСОКИХ ЭНЕРГИЙ [10-й семестр] (с.н.с. САМОХИН А.П.) . ... проф. СЛАВНОВ Д.А. Квантовая теория поля описывает фундаментальные законы современной физики. ... Квантовая теория поля является теоретической основой физики высоких энергий и физики элементарных частиц. ... Квантовая теория поля и физика фундаментальных взаимодействий. ... Введение в квантовую теорию поля. ...
... TELLING AMERICA'S STORY: NARRATIVE FORM AND THE REAGAN PRESIDENCY WILLIA M E LEWI S By 1980 , Americ a ha d los t its sense of direction . ... The n Ronal d Reaga n cam e ont o th e scene wit h a visio n of America that reinvigorate d th e nation . ... NARRATIV E FOR M I N REAGAN' S RHETORI C Reaga n tells tw o kind s of stories tha t differ in scale an d purpose , but that wor k togethe r to establish th e dominanc e of narrativ e form in th e creation and in th e interpretatio n of his rhetoric . ...
... 07.04.2016 (Thursday) Session 1 10:00-10:20 10:20-10:40 10:40-11:00 11:00-11:20 11:20-11:40 (chairman M. Stynes) N. Kopteva V. Andreev H.-G. Roos S. Franz, H.-G. Roos A posteriori error estimates for singularly perturbed reactiondiffusion problems on anisotropic meshes. ... Numerical solution of a singularly perturbed initial-boundary value problem with a Neumann condition for a parabolic equation. ... Boundary layer solutions to time-periodic singularly perturbed parabolic problems. ...
[
Текст
]
Ссылки http://math.phys.msu.ru/data/283/Programme_13th_Workshop.pdf -- 621.4 Кб -- 05.04.2016 Похожие документы
... The traditional answer to this question is unequivocal: тАЬno, public scholarship cannot and should not exist.тАЭ To popularize knowledge is to simplify, and simplification risks the loss of nuance and complexity, the very essence of scholarly knowledge. ... The public sphere can know but a distorted version of scholarly knowledge. ... You need JavaScript enabled to view it. (with Summer School-2016 in the subject line) before April 25, 2016. ... Summer School Archives . ...
... Data . ... MIR Station . ... Mir was the world's first consistently inhabited long-term research station in space, and the first 'third generation' type space station, constructed over a number of years with a modular design. ... Detectors of the instrument package allow observing fluxes of >0.1 MeV gamma-quants associated with bremstrahlung emission of high energy electrons of similar energies and with integral fluxes of high energy electrons (>5 MeV) and protons (>60 MeV). ... 60 MeV). ...
Ректору Московского государственного университета имени М.В. Ломоносова академику В.А. Садовничему от студента магистратуры 3 курса | факультета ВМК | ... ФИО полностью) | ...
... 000, 112 (2009) Printed 11 February 2010 A (MN L TEX style file v2.2) Analytical approximations of K -corrections in optical and near-infrared bands I1gor V. Chilingarian1 2 ,2,3 , Anne-Laure Melchior 1,4 and Ivan Yu. ... Received 2010 February 01; in original form 2009 August 14 ABSTRACT To compare photometric properties of galaxies at different redshifts, the fluxes need to be corrected for the changes of effective rest-frame wavelengths of filter bandpasses, called K -corrections. ... Table 1. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Mechmath admission for internetional students . Specialist degree . ... Specialist variants . Master degree . ... Master variants . ... Scientific Research Training . ... We?ll tell you what you need to know about the Festival of Science. ... What is the Festival of Science, and why is it so attractive to all who have participated in it?both children and adults?that they look forward eagerly to each new Festival? ... 2016 Mechmath admission for internetional students ...
Revised: 21 May 2014, Accepted: 27 May 2014, Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/jmr.2399 Force -induced globule-coil transition in laminin binding protein and its role for viral- cell membrane fusion Boris N. Zaitseva, Fabrizio Benedettib,e, Andrey G. Mikhaylovb, Denis V. Korneeva, Sergey K. Sekatskiib*, Tanya Karakouzb, Pavel ... 2008, 2010). ... This should permit us to elucidate still unclear aspects of viral-cell membrane interaction and fusion. ...
[
Текст
]
Ссылки http://cell.biophys.msu.ru/static/announce/media/files/Force-induced_globule-coil_transition_in_laminin_binding_protein_and_its_role_for_viral-cell_membrane_fusion.pdf -- 1182.2 Кб -- 30.11.2015 Похожие документы
О кафедре . ... Динамические задачи теории упругости . ... Группы преобразований в механике сплошной среды . ... Механика сплошной среды . Неклассические модели в механике сплошных сред . ... Неклассические модели в механике сплошных сред " Специальный курс лекций для студентов 3-5 курсов и аспирантов кафедры теории упругостиЛектор доктор физ.-мат. наук профессор Г.Л.Бровко . ... Основные элементы теории классической механики сплошной среды и пути их модификации в неклассических построениях. ...
ORM2010 Mechanisms for corruption suppression Alexander Vasin Pavel Nikolaev Anton Urazov Lomonosov Moscow State University The research was supp orted by Grant of the President of the Russian ... -00249 #693.2008.1 #08-01-00249 1 / 34 Introduction Government agencies and large corporations meet similar problems related to control of agents dealing with outsiders: citizens under audit of the agency or clients of the company ... 2005 . ... tl ) · fi + bil < fi , < X bil > pl+1 (t0 , . ... 2009. ...
[
Текст
]
Ссылки http://io.cs.msu.ru/ORM_present/Vasin_Nikolaev_Urazov.pdf -- 386.1 Кб -- 18.10.2010
[
Текст
]
Ссылки http://io.cs.msu.su/ORM_present/Vasin_Nikolaev_Urazov.pdf -- 386.1 Кб -- 18.10.2010
[
Текст
]
Ссылки http://io.cmc.msu.ru/ORM_present/Vasin_Nikolaev_Urazov.pdf -- 386.1 Кб -- 18.10.2010 Похожие документы
ISSN 0145 8752, Moscow University Geology Bulletin, 2013, Vol. ... On the Mechanism of the Generation of Seismic "Nails" V. S. Zakharov Faculty of Geology, Moscow State University, Moscow, 119991 Russia e mail: vszakharov@yandex.ru Received March 11, 2013 Abstract--The spatial and temporal peculiarities of seismic "nails" are analyzed. Some nails are related to strong earthquakes, or volcanic eruptions, while some do not show any coincidence with any fault zone or other tectonic structures. ...
[
Текст
]
Ссылки http://dynamo.geol.msu.ru/personal/vsz/papers/Zakharov_2013_3_eng.pdf -- 401.1 Кб -- 21.10.2013 Похожие документы
... Кафедры . ... Практика . Производственная практика 2015 . ... IS PLEASED TO WELCOME INTERNATIONAL STUDENTS TO . ... International students enjoy both a regular curriculum and an in-depth study of the Russian Language, Russian Culture and History of Russia. ... a certified Russian translation ofљ both the original of Secondary School Certificate (or equivalent) and its attachment. ... a certified copy of ID/passport (the original of ID/passport is to be produced on application) . ...
Lomonosov project . ... Mikhail Lomonosov . ... The studies of Lomonosov determined profile of Russian science forever, and we appreciate the discoveries of the leading Russian scientists as the studies of his direct learners and successors. A recognized and the most significant input of Lomonosov into natural science is molecular-kinetic theory of heat, developed during the prevalence of theory of specific fiery matter ? ... Lomonosov?s theory drawn wide response in European science. ... Aurora. ...
. NON-STATIONARY OPERATION OF THE FAST-FLOW LASERS . AND NEW POSSIBILITIES OF CONTROLLING THE LASER OUTPUT CHARACTERISTICS . A.V. Mushenkov, A.Yu.Loskutov, A.I.Odintsov, A.I.Fedoseev and V.F.Sharkov . Physics department of M.V.Lomonosov Moscow State University, 119899, Vorob'evy gory, Moscow, Russia . Abstract . The dynamics of the lasing of the fast crossflow gas laser with the inhomogeneous steady state pumping in the unstable resonator by means of numerical modeling is investigated. Depending on the