... The Laboratory of Bioorganic Chemistry and Molecular Imaging (LBCMI) at Swiss Institute of Technology, Lausanne (EPFL), Switzerland has an opening at the PhD level (http://lcbim.epfl.ch). ... The successful candidate should hold a master degree or equivalent in organic chemistry, chemical biology or other relevant discipline. ... The candidate should be open and interested in learning new techniques in biology and molecular imaging. ...

Еще в разделе: (Показать все результаты (>88) - www.chemport.ru/ )

• "Аналитик-исследователь" - вакансия в разделе "Работа для химиков" @ChemPort.Ru
• The Wordsworth Dictionary of Science and Technology / Научно-технический
• Выставка Tire Technology Expo 2013 // каталог химических выставок Химического

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• ConClus
• StructAlign feedback

... О факультете . Структура факультета . ... Cеминар "Scientific Writing in English. Problems in writing up research: How to overcome them?" ... Преподаватели факультета . ... Биологический факультет МГУ . ... Справочная телефонов МГУ +7 (495) 939-10-00 . ... 2016 Биологический факультет . ...

Еще в разделе: (Показать все результаты (>12) - www.bio.msu.ru/ )

... quantum optics - different types of the light interference, . ... Another branch of my activity covers the problem of biphoton interference (1997-). ... Also we developed the effective interferometric protocols to generate some specific quantum states of light (the Bell states) in the most common case: broad spectrum of the pump (in particular for the femtosecond laser), any type of phase-matching (either type-I or type-II), and arbitrary length of nonlinear crystals. ... QUANTUM TELEPORTER . ...

Еще в разделе: (Показать все результаты (>90) - qi.phys.msu.ru/ )

• Publications :: Quantum Information Laboratory

... ESA Space Weather Activities | ... Space Environments and Effects Analysis Section, | ... Introduction THE NATURAL SPACE ENVIRONMENT REPRESENTS A CONSIDERABLE HAZARD FOR SPACECRAFT AND THE EUROPEAN SPACE AGENCY (ESA) HAS FOR MANY YEARS TAKEN MEASURES TO ENSURE THAT ITS SPACECRAFT ARE ABLE TO SURVIVE AND OPERATE IN IT. ... 2.2 Radiation Effects As in other space agencies, ESA's concerns with space weather effects probably began with concerns over radiation effects on spacecraft systems. ... 2000). ...

Еще в разделе: (Показать все результаты (>100) - www.kosmofizika.ru/ )

• Science Technology: Ongoing Solar Activity

... THE TIME HAS COME FOR "THUNDER BOOKS" . ... You may have forgotten what a thunder book is, or maybe you didn't ever use that name. ... It is a handy reference to those things you need to know about soils and how they behave. ... Well, if you knew how to use them as pages in a thunder book it would surely be a good start, but you need something uniquely yours. ... It has always been my belief that the mission of a soil survey is to help people understand and wisely use soil resources. ... Good read. ...

Еще в разделе: (Показать все результаты (>3) - www.paleopedology.msu.ru/ )

... Sklyar V., Gladchenko M., Kurakova O., Shcherbakov S., Kalyuzhnyi S. UASB treatment of wine distillery wastewaters under mesophilic and submesophilic conditions. ... Kalyuzhnyi S.V., Gladchenko M.A., Sklyar V.I., Kurakova O.V., Shcherbakov S.S. The UASB treatment of winery wastewater under submesophilic and psychrophilic conditions. ... Wat. ... Kalyuzhnyi S.V., Gladchenko M.A., Sklyar V.I., Kizimenko Ye.S., Shcherbakov S.S. (2001) One- and two-stage UASB pretreatment of winery wastewater at 4-10 oC...

Еще в разделе: (Показать все результаты (>154) - www.enzyme.chem.msu.ru/ )

• productsM
• proj_past
• PubMed medline query

... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...

Еще в разделе: (Показать все результаты (>28) - observ.pereplet.ru/ )

• Обсерватория

... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...

Еще в разделе: (Показать все результаты (>8) - srd.sinp.msu.ru/ )

... 12, 43 ­ 44 (2012) / DOI 10.1002/pamm.201210013 Cases of Complete Integrability in Transcendental Functions in Dynamics and Certain Invariant Indices Maxim V. Shamolin1, 1 Institute of Mechanics, Lomonosov Moscow State University, Michurinskii Ave., 1, 119899 Moscow, Russian Federation The results of this work appeared in the process of studying a certain problem on the rigid body motion in a medium with resistance, where we needed to deal with first integrals having nonstandard properties. ...

Еще в разделе: (Показать все результаты (>43) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-133-1.pdf
• Mathematical Reviews

... Search The Server . ... The Russian Users Of The GeneBee Package . ... Up to 1995 several versions of the package were installed on personal computers in many institutions working in the field of the molecular biology. ... Institute of Molecular Biology, RAS . ... In May 1995 the GeneBee Group build the first version of web-server, which slowly becomes popular in worldwide molecular and biology society. ... In 1992 the GeneBee Group establish contacts with Oxford laboratory of molecular biology. ...

Еще в разделе: (Показать все результаты (>200) - www.genebee.msu.ru/ )

• GeneBee service
• Selected Scientific Journals - Search Engines
• Impact Factors of Scientific Journals in 1999

Поиск по МГУ | Лента новостей | ... McKinsey & Company Business technology office. ... Grant program of McKinsey Company Business technology office . ... McKinsey Company . ... McKinsey Business Technology helps clients harness the transformative power of technology to create business value for today, and step-function growth for tomorrow. ... Your motivation letter should tell us: 1) what interests you in Business Technology; 2) what will You bring to McKinsey s Business Technology office. ...

Еще в разделе: (Показать все результаты (>85) - www.msunews.ru/ )

Magnetism Department MSU . ... Education . ... Process of education on magnetism division . ... Different courses on classical theory of magnetic phenomena and on actual problems of modern theory of magnetism are read on magnetism division. ... Students of magnetism division do practical work on the 8th term with more then 50 students from other divisions each year. ... Physics of semiconductors division . ... oblig. – alt. ... Alexander Shaligin, associate prof. assessment . ... oblig. 519, 505 . ...

Еще в разделе: (Показать все результаты (>23) - magn.phys.msu.ru/ )

... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... https://cs.msu.ru/node/1707 . ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>15) - ani.cmc.msu.ru/ )

• The ASR Department at the CMC Faculty of Lomonosov MSU | Department of the
• The ASR Department at the CMC Faculty of Lomonosov MSU
• Courses | Department of the Automation for Scientific Research CMC MSU

Lessons learned from the Thirty Meter Telescope site testing Tony Travouillon Sebastian Els, Angel Otarola, Reed Riddle, Matthias Schoeck, Warren Skidmore TMT.XXX.PRE.05.0XX.DRF01 1 Introduction TMT and its Site testing. Important choice before going on site. ... Considerations during analysis of the data. TMT.XXX.PRE.05.0XX.DRF01 2 Some Background about the TMT Site Testing TMT is a 30m, segmented, RitcheyChretien telescope design. ... ASCA Cloud Cover Analysis So how do we do it in practice? ...

Еще в разделе: (Показать все результаты (>27) - site2010.sai.msu.ru/ )

• http://site2010.sai.msu.ru/static/doc/Site2010-Summary.pdf

... Science Park . ... Agency for networking, information and communication technologies ( NETINFOKOM LLC) ank-nic@rambler.ru http://www.msunews.ru/ . ... Developing the infrastructure and information support needed for projects that provide an interdisciplinary exchange of science information and the potential for collective work on the base of network services and technologies. ... The company has a great deal of experience in the design, development and penetration of laboratory information systems. ...

Еще в разделе: (Показать все результаты (>14) - www.sciencepark.ru/ )

• MSU Science Park - News
• MSU Science Park - Projects & Partners
• MSU Science Park

First Russian Conference . ... 7-9 June 2005, Moscow . ... Application of ozone in ecology . ... 20 January 2005 - mailing of the 2 nd information letter . ... The Conference is targeting to provide Russian specialists with the information about modern oxidative and inactivative ozone technologies using ozone as an unique disinfectant. ... In view of the Conference will be held in June, 2005, the regular 28th Workshop on Ozone and other environment friendly oxidants is postponed till December, 2005. ...

Еще в разделе: (Показать все результаты (>48) - www.kge.msu.ru/ )

• Archive

... This book contains scientific papers prepared by researchers of Moscow State University and Autonomous University of Puebla in accordance with a special Russian--Mexican scientific program. ... Institute of Mathematical Studies of Complex Systems, Moscow State University . ... Institute of Nuclear Physics, Moscow State University . ... The book is edited by Rector of Moscow State University Dr. V.A. Sadovnichii and Rector of Autonomous University of Puebla Dr. E. Doger Guerero. ...

Еще в разделе: (Показать все результаты (>82) - num-anal.srcc.msu.ru/ )

Submission Instructions Please read all instructions before completing the form. ... Name: | ... Name Phone | ... No Yes |( ... Are written and dated laboratory records and data available? ... Please provide date of defence or anticipated date of defence. ... Was the invention created using confidential information of a third party? ... result in similar information no longer being supplied to the University when | ... Inventor's signature(s) (if selecting option A, | ... Print Name Signature | ...

Еще в разделе: (Показать все результаты (>32) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/neuromotioncasestudy.doc
• http://www.innovation.msu.ru/english/survey.pdf
• Start-Up Company Development :: Управление инновационной политики и организации

... The last years give the experimental evidence of two such states at mass 1.4 GeV/c 2 and 1.6 GeV/c 2 [2, 3, 4, 5, 6, 7, 8, 9]. ... It removes such kind of ques­ tions as the correct calculation of the different apparatus acceptance, some distinctions of partial wave analysis, the different background contributions. So the evidences of 1 + exotic states at mass 1.4 GeV/c 2 (p 1 (1400)) and 1.6 GeV/c 2 (p 1 (1600)) are very weighable. ... There is another question concerning to the 1 + exotic decay. ...

Еще в разделе: (Показать все результаты (>51) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/rdmscms/bul1.html
• http://lav01.sinp.msu.ru/~vlk/UPC_2002.pdf