... MOLECULAR SPECTROSCOPY The Effect of Hydration of Ions of Inorganic Salts on the Shape of the Raman Stretching Band of Water S. A. Burikov, T. A. Dolenko, P. A. Velikotnyoe, A. V. Sugonyaev, and V. V. Fadeev Moscow State University, Moscow, 119992 Russia Received April 23, 2004 Abstract--The shape of the Raman stretching band of water molecules in aqueous solutions of electrolytes KBr, KCl, KI, NaCl, and NaI is studied. ... We used high purity grade and reagent grade salts. ...

Еще в разделе: (Показать все результаты (>44) - rswater.phys.msu.ru/ )

• Laboratory of laser spectroscopy of solutions of supramolecular compounds and

... There is a serious question in Congress' agenda - strategy of Higher School development, and certainly, vital problems of your institutions, especially actual in the current economic situation. ... A month ago, I have given several commissions, aimed to support Russian students, the system of higher professional education and job placement of graduates. ... I would like to mention that legal requirements to establish Federal and national research universities are formulated now. ...

Еще в разделе: (Показать все результаты (>48) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/396.doc
• http://www.rsr-online.ru/doc/norm/328.doc
• http://www.rsr-online.ru/doc/norm/111.doc

... All papers not in accordance with these standards will be removed from the publication if malpractice is discovered at any time. All submitted papers are evaluated in the standard single-blind peer review process involving at least two reviewers. ... Authors submitting their works for publication as original papers confirm that the submitted works represent their authors' contributions and have not been copied or plagiarized in whole or in part from other works without clear citing. ...

Еще в разделе: (Показать все результаты (>163) - num-meth.srcc.msu.ru/ )

• "NPB UA benchmark scaling to thousands of Blue Gene/P cores using PGAS-like
• "Numerical modeling of dispersive billiards. Part II"
• "Numerical modeling of dispersive billiards. Part I"

... Институт . ... Студентам . Приветствуем вас на Официальном сайте Русско-германского института науки и культуры. Published by admin on April 6, 2016 under Новости . ... No Comments ? ... 09.00 - 15.30 љ љљ 736 - 1.ГУМ . ... Морозова Е.Б. пн. љ17-00? 18-30, 18-45?20-15, 20-30?21-15љ 1 к., ауд.736 1 ГУМ . ... Башкиров В. М. вторник 15.00-17.00, четверг љ15.00-17.00, 1 ГУМ ауд.736 . вторник 17.00-19.00, пятница 17.00-19.00 1 ГУМ ауд.736 . ... 736 1 Гум) . ... 7361 Гум) . ... December 2011 . ...

Еще в разделе: (Показать все результаты (>2) - rgi.msu.ru/ )

... Science . ... lrm@cs.msu.su . ... The Laboratory of Difference Methods was founded by A.A.Samarsky, Academician of RAS, in the middle of the 60s. For more than 50 years the Laboratory?s theoretical research has been focused on numerical methods for problems described by systems of partial differential equations. ... N.V.Ardelyan, V.L.Bychkov, I.V.Kochetov and K.V.Kosmachevskii, Non-self-maintained discharge plasma in propane-air mixture // IEEE Trans. on Plasma Science, vol. 39. no. 12, part 1, pp. ...

Еще в разделе: (Показать все результаты (>247) - en.cs.msu.ru/ )

• Laboratory of Mathematical Physics | CMC MSU
• Department of Functional Analysis and its Applications | CMC MSU
• Send by email | CMC MSU

ВМиК-Online! ... Факультет . ... Абитуриенты . ... Вариант письменного вступительного экзамена . по английскому языку . Отделение бакалавров факультета ВМиК . ... They found that cannabis users are 40 percent less effective in fighting viruses than normal people. ... Группа В Контакте для абитуриентов ВМК МГУ: . Поступление на ВМК МГУ 2012 . Форум абитуриентов ВМК МГУ . ... Телефон приемной комиссии факультета ВМиК МГУ: . ... 2001 2012 ВМиК Online! ...

Еще в разделе: (Показать все результаты (>6) - www.cmc-online.ru/ )

... Letters in Applied Microbiology [Let Appl Microbiol] . Common information . ... 1.593 . ... 1472-765X . ... since 1990-01-01 till today . ... biology ->microbiology . ... Part of Journal of Applied Microbiology . ... http://www.blackwellpublishing.com/jo.. ... today . toc, abstract, full-text . http://www.blackwell-synergy.com/loi/lam . ... full-text . http://elibrary.ru/issues.asp?id=2676 . ...

Еще в разделе: (Показать все результаты (>96) - journals.genebee.msu.ru/ )

... Give Russian equivalents of the following words and expressions: to be a very small part of ..., to consist of ..., to be called ..., to radiate from ..., to move around ..., to be circular (oval), to be hot, this is why, to change, to be smaller than ..., to reflect light, to shine by reflecting the sun's light, except, without smth., like smth., a head, a tail, to belong to ..., to come back to..., at regular intervals. ... 7 Rocks and minerals Three kinds of rock make up the crust of the earth. ...

Еще в разделе: (Показать все результаты (>150) - ffl.msu.ru/ )

• Иностранным гражданам
• International Students
• About Us

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... Octoshell: Lightweight and Innovative Cluster Management System . ... Volgograd State University . ... AREA: Georgaphy and Land Hydrology, Mechanics . ... Research Computing Center (RCC) of Lomonosov Moscow State University . Supercomputing Consortium of Russian Universities . ... Supercomputing Education . ... Nationwide Supercomputing Education Project . Supercomputing Education Books Series . ...

Еще в разделе: (Показать все результаты (>44) - hpc.msu.ru/ )

• MSU's HPC HISTORY | Moscow University Supercomputing Center
• X-COM: DISTRIBUTED COMPUTING SOFTWARE | Moscow University Supercomputing Center
• APPLICATIONS: High Molecular Weight Compounds | Moscow University

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• ConClus
• Nhunt: program for nucleic acid sequence similarity search

... A11, 1393, doi:10.1029/2001JA005073, 2002 Statistical distributions of field-aligned electron events in the near-equatorial magnetosphere observed by the Low Energy Plasma Analyzer on CRRES G. A. Abel,1 A. N. Fazakerley, and A. D. Johnstone2 Mullard Space Science Laboratory, University College London, Holmbury St. Mary, Dorking, Surrey, UK Received 27 August 2001; revised 26 April 2002; accepted 22 August 2002; published 22 November 2002. ... FIELD-ALIGNED ELECTRON EVENTS SMP 29 - 3 Figure 1. ...

Еще в разделе: (Показать все результаты (>211) - www.kosmofizika.ru/ )

• http://www.kosmofizika.ru/pdf1/abel_02b.pdf
• http://www.kosmofizika.ru/pdf2/cosr560_1.pdf
• L.Lazutin, List of publications

... Семинары . ... UNИX . ... Immutable Page . Comments . ... Attachments . More Actions: Raw Text Print View Render as Docbook Delete Cache ------------------------ Check Spelling Like Pages Local Site Map ------------------------ Rename Page Copy Page Delete Page ------------------------ My Pages Subscribe User ------------------------ Remove Spam Revert to this revision Package Pages Sync Pages ------------------------ Load Save SlideShow . ... Участие в семинаре. ...

153. April 2012 Лаборатория лазерной интерферометрии

154. http://www.innovation.msu.ru/english/guidetomarketresearch.doc

155. Colloquium on 10.04.08 Laboratory of Chemical Thermodynamics

156. http://www.icho39.chem.msu.ru/html/english/Participation/Pre-arrival%20circular.pdf

157. Moscow Society of Naturalists

158. A.S.Rubashny, D.D. Sokoloff, Mean magnetic energy in Riemannian spaces of

159. Igor Antokhin

160. http://www.iisi.msu.ru/UserFiles/File/bayern2009/crain_pres.pdf