... Home Our Team Staff Gennady F. Voronin . ... Bio : Was born in Moscow region , USSR (1935). Graduated and post-graduated from the Moscow State University (1958 and 1960)., ... Work at the Department of Chemistry of the Lomonosov Moscow State University: Junior Research Fellow (1960), Senior Research Fellow (1966), Head of the research laboratory of Chemical Thermodynamics (1976 - present). ... Colloquium on 24.12.12 20 Dec 2012 . ... Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>92) - td.chem.msu.ru/ )

• Colloquium on 24.02.11 Laboratory of Chemical Thermodynamics
• Colloquium on 21.02.08 Laboratory of Chemical Thermodynamics
• Colloquium on 26.02.09 Laboratory of Chemical Thermodynamics

... About/history Contacts Administration Education Staff . Laboratories: . Inorganic Materials Sciences . Chemistry of Coordination Compounds . ... Inorganic Synthesis . ... At the initial stages the main focus of research was the chemistry of beryllium and its compounds, in particular, beryllium fluoride and fluoroberyllates of metals. ... Supramolecular inorganic chemistry and cluster chemistry remained the central research directions of the laboratory through the 1990s. February 2004 . ...

Еще в разделе: (Показать все результаты (>66) - www.inorg.chem.msu.ru/ )

• Prof. Dolgikh group. June 2010

. Summary of experimental results . The light absorbing capacity of phytoplankton, estimated from Fo , and its photosynthetic activity (estimated as Fv/Fm ) are key characteristics of the primary processes of photosynthesis. We suggested a formula for calculation of the primary production of phytoplankton from these two characteristics and underwater irradiance. The probing data were used to plot vertical profiles of phytoplankton productivity in various regions of the Baltic, Norwegian, and South China

Еще в разделе: (Показать все результаты (>9) - www.biophys.msu.ru/ )

• THE PRINCIPLES OF THE DOUBLE-FLASH FLUOROMETRY

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Глумление над реестром. Desktop. ... Имя рядом с системными часами. ... Как побороть глюки с иконками в Active Desktop. ... HKEY_CURRENT_USER\Software\Microsoft\Windows\CurrentVersion\Policies\Explorer или . ... Найдите раздел HKEY_CURRENT_USER/Control Panel/Desktop и создайте в нем два строковых параметра WallpaperOriginX и WallpaperOriginY. ... Чтобы отключить active desktop в win98 нужно в HKEY_CURRENT_USER\SOFTWARE\Microsoft\Windows\CurrentVersion\Policies\Explorer . ... имя: . ...

Еще в разделе: (Показать все результаты (>29) - www.kge.msu.ru/ )

• Laboratory of Catalysis and Gas Electrochemistry

... L Сd , Pol a nd ABOUT EFFECTIVE MODES METHOD FOR DESCRIPTION OF INTERNAL DYNAMICS OF WEAKLY BOUND CLUSTERS Elena Belega, Evgeny Cheremukhin 1 , Dmitry Trubnikov Abstract: New approach to describe the internal dynamics of weakly bound clusters is presented. ... It is found that the number of active collective modes depends on the initial cluster excitation and that the internal energy is partitioned nonuniformly among the modes. ... Collective motion of oxygen atoms performs mostly in plane. ...

Еще в разделе: (Показать все результаты (>18) - beams.chem.msu.ru/ )

... О UNИX . ... HelpOnTables . ... Table Markup . ... General table layout and HTML like options . ... Line breaks within cells . ... Bulleted lists and other complex content within cells To create a table, start & end a new line using the table marker; two 'pipe' characters " || ... top left cell || top right cell || || bottom left cell || bottom right cell || ... Just use CSS-formatted styles and it will be inlined in the generated HTML tag. <style="..."> will put that style info into cell (td) html ...

Еще в разделе: (Показать все результаты (>152) - uneex.mithril.cs.msu.su/ )

• HelpOnActions/AttachFile - UNИX
• HelpOnAutoAdmin - UNИX
• Index of /static/DocsKdeOrg_digiKam/docs.kde.org/stable/common

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ WHAT EVIDENCE EXISTS FOR PALEOTSUNAMI TRIGGERED BY LOCAL EARTHQUAKES IN THE WELLINGTON REGION OF NEW ZEALAND? ... Recently a study was carried out to document evidence for large earthquakes in the Holocene sedimentary record of the Wellington region of New Zealand [Cochran, 2002]. ... T ECTONIC SETTING New Zealand lies (Figure 1). ...

Еще в разделе: (Показать все результаты (>22) - seac47-2.phys.msu.ru/ )

• LOCAL TSUNAMI WARNING AND MITIGATION -- Proceedings Download Page

The files containing information about Affymetrix microarrays were downloaded from the official Affymetrix site. ... Probe sequences were mapped to the genome using Blat. ... The hits found "probe alignment regions" were . ... We annotated each probe alignment region using the mRNA and EST alignments provided by UCSC, considering only . ... The textual part of the interface consists of probe information section, probe alignment section and transcription state . ... Each gene and each probe alignment . ...

Еще в разделе: (Показать все результаты (>6942) - mouse.belozersky.msu.ru/ )

. Home . Commission Members . Meetings . Newsletters . Forum . Electronic magazines . Commission publications . Forum archive . International Union of Soil Science . Commission on Paleopedology . International Union for Quaternary Research . Subcommission on Paleopedology . IUSS . << RERUM COGNOSCERE CAUSAS .

Еще в разделе: (Показать все результаты (>9) - www.paleopedology.msu.ru/ )

• INQUA
• Commission publications
• On-line publications

.

Еще в разделе: (Показать все результаты (>37) - www.chemport.ru/ )

• "R scientist/expert in catalysis-related chemistry, phd" - вакансия в разделе
• "Business development manager" - вакансия в разделе "Работа для химиков"
• "Sales manager, biochemical reagents (for usa residents)" - вакансия в разделе

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>18) - comphep.sinp.msu.ru/ )

• extra:model:main [CompHEP]
• devel:main [CompHEP]
• devel:stat [CompHEP]

The Department of Talented Youth Affairs and Professional Orientation . ... News . ... Older posts . Newer posts . Posted on 02.02.2016 by editor . ... Posted in News | Leave a comment . ... Deadline for applications: 02/29/2016 The purpose of the contest is to encourage talented Continue reading . ... Posted in News , Без рубрики | ... Posted on 28.12.2015 by editor . ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>56) - talant.msu.ru/ )

• admin | The Department of Talented Youth Affairs and Professional Orientation
• Our Graduate Will Represent Lomonosov Moscow State University during the
• Moscow State University will host the biggest chemistry team tournament for

... About Journal | ... Sociology and Political Science publishes original works on sociology and political science, results of research and experiments in social and political spheres in Russia and abroad, methodological innovations, information about conferences, reviews of the recent books in sociology and political science. ... Please include full article title both in Russian and English. ... Information about the author/authors both in Russian and English. ... References. ...

Еще в разделе: (Показать все результаты (>36) - www.socio.msu.ru/ )

• English version - Социологический факультет МГУ

... Полная версия: Мелодии со Звездочки . Грация-МГУ::Форум > Мультимедия > Аудио . Ksafani . Jun 29 2007, 10:18 . ... На Звездочке ставили замечательное танго - Nelly Furtado, назывеется кажется "Say It Right". ... Цитата(Ksafani @ Jun 29 2007, 11:18) . ... Jul 1 2007, 09:45 . К сожалению точно не помню, кажется в D, хотя могу ошибаться... клип на песню(правда не в обработанном под танго виде), часто крутят на ТВ, все равно спасибо что посмотрели. ...

Еще в разделе: (Показать все результаты (>41) - grace.msu.ru/ )

• Грация-МГУ::Форум > Отмена занятий 1-2 декабря
• Грация-МГУ::Форум > Разрешенные фигуры N-класса
• Грация-МГУ::Форум > Чек в Нью-Йорке

... February, 2006 . ... Moscow State University Russian Language Centre . Moscow State University . ... Learn Russian at the Moscow State University! On Friday, on February, 17th, in the Boardroom of the Academic council of the Moscow State University with lecture Minister for Foreign Affairs of Kingdom Norway mister Junas Gar Styore has acted. (more.. ... In the first days of March students of the center celebrated an ancient Russian holiday Maslenitsa (pancake week). ...

Еще в разделе: (Показать все результаты (>7) - www.rlcentre.com/ )

Aleksanteri Institute Visiting Scholars Programme Aleksanteri Visiting Fellowships 2013 ­2014 THE FELLOWSHIP Is intended for scholars who hold a PhD degree in a field relevant to the Aleksanteri Institute 's research agenda and whose place of residence i s outside of Finland Is for a period of two to three months between August 2013 and June 2014 Involves a research stay at the Aleksanteri ... An electronic application form 2. ... The applications are evaluated by three experts. ...

Еще в разделе: (Показать все результаты (>43) - www.mgubs.ru/ )

• http://www.mgubs.ru/images/Image/CallforApplications22Apr09.txt
• Преподаватели ВШБ МГУ Сергей Заверский и Наталья Чуркина выступили на

... Processes of regionalization in Post-Soviet space: contradictions of Russia-Belarus Integration. Moscow, Institute of economy RAS, 2010. ... Eurasian Economic Integration. ­ 2010, 1. 4. 10 years of EurAsEC: everything is just starting (in co-authorship with R. Grinberg)./ ... Scientific Reports of the Institute of Economics of RAS. ... Analytical Bulletin of the Centre for Problems of Globalization and Integration of Institute of economics of Russian Academy of Sciences", 2007, Issue 4 (12). ...

Еще в разделе: (Показать все результаты (>22) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/RAS_Resolution.pdf
• http://www.mse-msu.ru/Nekipelov_comment_on_reserve.pdf
• http://www.mse-msu.ru/images/Sapir_trnslt.pdf

... 8 OpenFlow , , , , , , NAT, ARP, DNS, DHCP, BGP , , web · ­ · events per second · >10M · "" ­ · us · ­ 24/7 · ­ : ­ (2013) · · · · · · · · · NOX-Classic NOX Beacon Floodlight SNAC Ryu POX Maestro Trema · · · · · · · · · Helios FlowER MUL McNettle NodeFlow Onix SOX Kandoo Jaxon · Cisco ONE controller · Nicira NVP Controller · Big Network Controller · IBM Programmable Network Controller · HP SDN Controller · NEC Programmable Flow 11 · ­ ­ · ­ · ­ · ­ OpenFlow 12 5/30/2013 13 (2013) · 7 000 000 . ...

Еще в разделе: (Показать все результаты (>7) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~dimawolf/ArchEVM/Lection12.pdf

. Адрес: 119992, ГСП-2, Москва, Ленинские горы, МГУ, Главное здание, А-1008 . тел.: (095) 939 37 67 факс: (095) 939 02 59 . Все права на материалы, опубликованные на сайте Управления, принадлежат МГУ им.М.В. Ломоносова. При использовании материалов сайта ссылка на наши выходные данные обязательна. Просим сообщать нам о замеченных неточностях и опечатках. Webmaster . 2002-2005 УОСиП МГУ All rights reserved .

Еще в разделе: (Показать все результаты (>11) - www.edst.msu.ru/ )

• Информация