... Форумы > Аспирантура > Тема . ... Аспирантура в Порту, Португалия . ... Grant call on E-Careers site: . ... Research Grant . ... Position/ Grant: PhD Research Grant. Generic scientific area: Engineering. ... Location: University of Porto, Faculty of Engineering, Department of Informatics Engineering (FEUP-DEI), http://www.fe.up.pt . ... This PhD research grant requires the completion of a PhD at the Department of Informatics Engineering, Faculty of Engineering, University of Porto (FEUP-DEI). ...

Еще в разделе: (Показать все результаты (>105) - www.mmonline.ru/ )

• MMOnline | Форумы | Разное | Publication/Reference Managers
• MMOnline | Форумы | Аспирантура | PhD position in the University of Florida
• MMOnline | Новости | Международная конференция Combinatorial methods in physics

... Smurova KM, Alieva IB, Vorob'ev IA. Free and centrosome-attached microtubules: quantitative analysis and themodeling of two-component system. ... Genes Cells. ... Mimori-Kiyosue Y, Grigoriev I, Lansbergen G, Sasaki H, Matsui C, Severin F, Galjart N, Grosveld F, Vorobjev I, Tsukita S, Akhmanova A. CLASP1 and CLASP2 bind to EB1 and regulate microtubule plus-end dynamics at the cell cortex. J Cell Biol. ... Cell Biol Int. 2004;28(2):139-50. ... Membr Cell Biol. 1997;11(2):195-211. in Russian . ...

Еще в разделе: (Показать все результаты (>36) - cellmotility.genebee.msu.ru/ )

• Cell Motility Lab

A wide group of electrocatalytic and corrosion phenomena on metals, alloys, oxides and composite materials in aqueous and aprotic media is under study. ... Basic investigations of electrocatalysis theory, mechanisms of electrocatalytic processes and charge transfer elementary act in heterogeneous systems are in the center of attention, first of all, the experimental verification of modern quantum-mechanical theory of elementary act by means of using non-traditional model reactions. ...

Еще в разделе: (Показать все результаты (>17) - www.elch.chem.msu.ru/ )

• Laboratory of Electrochemical energetics
• Laboratory of Electrical Double Layer and Electrode Kinetics
• Pron'kin Sergey Nikolayevich

... Voronov, Vasiliy. Scalability and efficiency of parallel power grid simulations on massively-parallel platforms (submitted). ... 2009. ... Voronov, Vasiliy and Popova, Nina. ... Conference proceedings 2010. ... Abstract Book of SIAM Conference on Parallel Processing for Scientific Computing (SIAM PP10). ... Proceedings of the International Conference on Parallel Computing (ParCo-2009). ... IEEE Computer Press. ... Pozdneev, Alexander and Popova, Nina and Voronov, Vasiliy. ...

Еще в разделе: (Показать все результаты (>2) - angel.cmc.msu.ru/ )

• Vasiliy Yu. Voronov homepage

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus

P.V.Korolenko, N.N.Fedotov, V.F.Sharkov. Main properties and potential practical applications of M-mode lasers. ... T.I.Arsenyan, P.V.Korolenko, E.A.Kuliagina, N.N.Fedotov. ... T.I.Arsenyan, N.N.Fedotov, L.S.Kornienko, P.V.Korolenko, E.A.Kulyagina, G.V.Petrova Laser beams with helical wavefront dislocations and their applications in the diagnostical and metrological systems. // 5-th International Conference "Industrial Lasers and Laser Applications '95" (Shatura, Moscow reg., ...

Еще в разделе: (Показать все результаты (>6) - optics.sinp.msu.ru/ )

O.A. Aktsipetrov, E.A. Gan'shina, V.S. Guschin, T.V. Misuryaev, T.V. Murzina. Magneto-induced second harmonic generation and magneto-optical Kerr effect in Co-Cu granular films. ... A.A. Fedyanin, T.V. Misuryaev, T.V. Murzina, and O.A. Aktsipetrov. ... O.A. Aktsipetrov, A.V. Melnikov, T.V. Murzina, A.A. Nikulin, A.N. Rubtsov DC-electric-field-induced optical second harmonic generation at the smooth metal-electrolyte interface // Surf. ...

Еще в разделе: (Показать все результаты (>41) - shg.phys.msu.ru/ )

• All Publications Info Pad
• Publications Keywords Search
• List of Publications

... О факультете . Структура факультета . ... Научная работа . ... Коллеги, у Вас есть возможность публиковать научные статьи в Peer-Reviewed Open Access Journals: . Журнал ?Международные научные публикации: Экология и Безопасность (ISP:ES), Том 5, ISSN: 1313-2563 . Журнал ?Международные научные публикации: Материалы, Методы и Технологии (ISP:MMT), Том 5, ISSN: 1313-2539 . ... Д 501.001.20 - все защиты . ... все защиты ? ... Биологический факультет МГУ . ... 2016 Биологический факультет . ...

Еще в разделе: (Показать все результаты (>7) - www.bio.msu.ru/ )

• Master In Ecology ? Биологический факультет МГУ

Вы посетили: arzhantsev_s_a_publications . ... История кафедры . ... On restriction of roots on affine T-varieties, Beitr?ge zur Algebra und Geometrie / Contributions to Algebra and Geometry 55 (2014), no. ... Journal of Pure and Applied Algebra 218 (2014), no. ... Сибирский математический журнал 53 (2012), вып.6, 1354-1372 . ... Математический Сборник 203 (2012), вып.4, 47-60 . ... staff/arzhantsev_s_a_publications.txt Последние изменения: 10.05.2015 22:32 От arjantse | ...

Еще в разделе: (Показать все результаты (>23) - halgebra.math.msu.su/ )

• staff:arzhantsev_publications | Кафедра высшей алгебры

... About Journal | ... Sociology and Political Science publishes original works on sociology and political science, results of research and experiments in social and political spheres in Russia and abroad, methodological innovations, information about conferences, reviews of the recent books in sociology and political science. ... Please include full article title both in Russian and English. ... Information about the author/authors both in Russian and English. ... References. ...

Еще в разделе: (Показать все результаты (>45) - www.socio.msu.ru/ )

... Data representation The key concept in the following consideration is a metal ion complexation profile. ... Zernov / Analytica Chimica Acta 455 (2002) 131­142 I.V. Pletnev, V.V. Zernov / Analytica Chimica Acta 455 (2002) 131­142 135 Ag + Al3 + Ba2 + Be 2+ Ca2 + Cd 2+ Ce3 + + Co2 Cu2 + Fe2 + Fe3 + + H Hg 2+ K + La3+ ) (Na+ ) Ba2+ ( Fe3 + ) (Y3+ ) Hg2 + Pb2 + Fe2+ Sr 2+ Cd2 + (UO2 2+ ) (La3+ ) ( Al3 + ) (K+ ) Zn2+ Co2+ Cu2+ ( Ce3 + ) Mn2 + Ni2+ ...

Еще в разделе: (Показать все результаты (>50) - analyt.chem.msu.ru/ )

• Лаборатория Электрохимических Методов
• The Molecular Mechanic Approach to Coordination Compounds: Force Field Based on

.

Еще в разделе: (Показать все результаты (>17) - www.chemport.ru/ )

... Veselovsky, V.A., Djanumov D.A. The use of biophysical methods in the study of adaptive reactions of plants, in connection with the problem of resistance. ... Kulaeva, O.N., Mikulovich T.P., Veselova, T.V., Veselovsky, V.A., Kukina, I.M., Klyueva N.Yu. ... Veselovsky, V.A., Veselova T.V . ... Nauka, Moscow (in Russian).1990. 200 p. Veselova T.V., Veselovsky V.A., Chernavsky D.S. Stress of Plant: A Biophysical Approach. ... Veselova T.V., Veselovsky V.A. Photosynthesis and stress of plant cells. ...

Еще в разделе: (Показать все результаты (>5) - biophys.msu.ru/ )

• CURRICULUM VITA

... 46. to give account of... 47. current (n.,adj.) . ... 57. complete v. adj. ,completely . ... 88. equal (v, adj), equally . ... 127. involve, involved (p.I, adj) . ... 134. to mean, meaning (less), means, by means of, mean (adj) . ... 145. reciprocal ( reciprocal relation) . ... 153. result, as a result, to result in / result from . ... 173a. reciprocal ( reciprocal relation) . ... Некоторые часто используемые слова: . ... новости студенты преподаватели лаборатории интернет-олимпиада по химии . ...

Еще в разделе: (Показать все результаты (>3) - www.students.chemport.ru/ )

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... Octotron: Active Control for Reliable Functioning of Supercomputers . Octoshell: Lightweight and Innovative Cluster Management System . ... Performance System Analysis . ... X-COM: Distributed Computing Software . ... Research Computing Center (RCC) of Lomonosov Moscow State University . ... Supercomputing Education . ... Nationwide Supercomputing Education Project . Supercomputing Education Books Series . ...

Еще в разделе: (Показать все результаты (>66) - hpc.msu.ru/ )

• TOP50 RATING: THE MOST POWERFUL SUPERCOMPUTERS OF CIS | Moscow University
• APPLICATIONS: Mathematics | Moscow University Supercomputing Center
• APPLICATIONS: Plasma Physics | Moscow University Supercomputing Center