... Measurement of the MASS detectors parameters with mass program January 24, 2015 [112707] . MASS/DIMM electronics. ... Turbina-core(D): Dimm User Guide. ... N.Shatsky, V.Kornilov, The revision of the MASS/DIMM star catalogue. ... О.Возякова, В.Корнилов, Н.Шатский, Новое программное обеспечение прибора MASS/DIMM. ... V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site. ...
Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...
... О КАФЕДРЕ ? ... GENERAL INFORMATION ABOUT THE CHAIR . ... Кафедра ЮНЕСКО по изучению глобальных проблем и возникающих социальных и этических вызовов для больших городов и их населения на факультете глобальных процессов Московского государственного университета имени М.В. Ломоносова . ... Cоздание кафедры ЮНЕСКО на факультете глобальных процессов МГУ открыло новые возможности для научных исследований в области возникающих глобальных социальных и этических проблемљ и для их преподавания. ...
... Vol. ... Translated from Biofizika; Vol. ... CELL BIOPHYSICS Effects of Electric Field on Spatiotemporal Patterning in the Reaction-Diffusion System A. I. Lobanov-, T. Yu. ... Abstract-A model is proposed that describes electrodiffusion in the layer adjacent to the cell membrane. The model takes into account chemical reactions at the membrane, Coulomb interactions between particles, their random motion (diffusion), and the effect of an external electric field. ... BIOPHYSICS Vol. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... http://www.univ-lorraine.fr/ . We have long-time collaboration with scientists from Laboratoire de Physique Moleculaire et des Collisions, Institut de Chimie, Physique et des Materiaux. 14 joint papers were published so far. ... http://www.uclouvain.be/ . ... There were published about 10 joint papers on mathematical aspects of few-body scattering theory in the case of Coulomb potentials. ... http://www.phys.msu.ru/ . ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...
... История курсов . ... close this panel . ... Выпускной класс . Старшие классы . Младшие классы . ... Прием на курсы . ... График мероприятий . ... Телефоны, адреса . График работы . ... Приветствуем вас на сайте Общеуниверситетских подготовительных курсов.љ ... Обращаясь на курсы через форму "Задать вопрос", будьте внимательны при написании своего электронного адреса.љ . ... Сайт общеуниверситетских . подготовительных курсовљ . ...
PHYSICAL REVIEW A, VOLUME 61, 052305 Analysis of radiatively stable entanglement in a system of two dipole-interacting three-level atoms I. V. Bargatin, B. A. Grishanin, and V. N. Zadkov International Laser Center and Department of Physics, M. V. Lomonosov Moscow State University, Moscow 119899, Russia Received 29 November 1999; published 7 April 2000 We explore the possibilities of creating radiatively stable entangled states of ... II only two transitions in the whole system. ...
... Study of the nature and magnitude of buffer capacity in various soils, information on mechanisms of buffer reactions is required to predict the rates of further acidification and to estimate the critical loads. ... The problem of estimation of soil sustainability to acid deposition is considered. ... The uncertainty in the estimated critical load values can be rather large due to uncertainty in critical chemical values for the soil as for a receptor, assessment method and data. ...
... The technique had been developed for calculating destruction of melting vitreous bodies in hypersonic gas flows taking into account the internal radiative transfer. ... The problem of flow in the chemically non-equilibrium boundary layer at a stagnation point of blunt body had been solved by the asymptotic method and formulas for the heat and diffusion fluxes to a surface of any catalycity had been obtained. ...
... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...
... Control of the Frequency Spectrum of a Biphoton Field Due to the Electro Optical Effect K. G. Katamadzea, A. V. Paterovaa, E. G. Yakimovab, K. A. Balyginc, and S. P. Kulik a b a Faculty of Physics, Moscow State University, Moscow, 119992 Russia Institute of Physics and Technology, Russian Academy of Sciences, Nakhimovskii pr. ... Akademika Kurchatova 1, Moscow, 123182 Russia Received June 29, 2011 A method for controlling the spectrum of spontaneous parametric down conversion has been implemented. ...
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...
Article pubs.acs.org/ac Enumeration of Labile Hydrogens in Natural Organic Matter by Use of Hydrogen/Deuterium Exchange Fourier Transform Ion Cyclotron Resonance Mass Spectrometry Yury Kostyukevich,,§ Alexey Kononikhin,,§ Igor Popov, Andrey Konstantinov, and Eugene Nikolaev*,,, , § Oleg Kharybin ... Chem. ... The relative intensity of the peak corresponding to n exchanges with depth of exchange P equals 11009 h(n) = CN nP n(1 - P)N -n (1) Here N is the total number of labile hydrogens. ...
[
Текст
]
Ссылки http://www.mgumus.chem.msu.ru/publication/2013/2013-Kostyukevich-etal.pdf -- 2485.5 Кб -- 04.12.2013
[
Текст
]
Ссылки http://mgumus.chem.msu.ru/publication/2013/2013-Kostyukevich-etal.pdf -- 2485.5 Кб -- 04.12.2013 Похожие документы
... The linguistic aspects of the model and the properties of the semantic dictionary ensuring the content analysis with compression of the text structure are considered. Our dictionary resources serve an instru- ment for building a multilevel textual semantic structure. ... Reason (A,B), where SemF(A) = SIT or a whole semantic formula; the same for SemF(B). ... Sem(SIT)R . ... Semantic Resources for Textual Content Compression // Fourth International Conference on Meaning-Text Theory (MTT'09). ...
Dynamo Theory and Earth's Magnetic Field Paul Demorest May 21, 2001 1 Intro duction The Earth's magnetic field belongs in that class of physical phenomena which are commonplace yet also very complex. ... 3 Single Disc Dynamo Before we dive into the mess of equations and approximations that describe how fluid motion and magnetic field interact, it is useful to demonstrate a very simple system which exhibits dynamo action. ... A system without fluid motion cannot support a magnetic field indefinitely. ...
[
Текст
]
Ссылки http://ocean.phys.msu.ru/courses/geo/lectures-addons/15/2001%20Demorest%2C%20Dynamo%20theory%20and%20Earth's%20magnetic%20field%20.pdf -- 266.6 Кб -- 07.12.2009 Похожие документы
... Новости лаборатории . ... 2002 год . ... Selective formation of C 60 F 18 (g) and C 60 F 36 (g) by reaction of [60]fullerene with molecular fluorine", J. Fluorine Chem. ... 2) A.D. Darwish, I.V. Kuvytchko, X.W. Wei, O.V. Boltalina, I.V. Gol'dt, J.M. Street, R. Taylor. ... 5) K. Ohkubo, R. Taylor, O.V. Boltalina, S. Ogo, S. Fukuzumi. ... 10) X.W. Wei, A.G. Avent, O.V. Boltalina, J.M. Street, R. Taylor. ... Copyright 2006-2012, Лаборатория термохимии, Московский государственный университет . ...
... The motion of the Chaplygin sphere with an additional constraint forc ing the point of contact to remain on a straight line was investigated by A.P. Veselov and L.E. Veselova in [6]. ... We consider the problem of a sphere (Chaplygin sphere) rolling on a plane and subject to a nonholo nomic constraint (the Veselova constraint) [7] (, E) = 0, where E is the unit vector fixed in space. ... As is well known [4], the arising system proves to be equivalent to the Veselova problem and is integrable. ...