... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... Institute of Mechanics, Lomonosov Moscow State University, Michurinsky Prospekt, 1, 117192, Moscow, Russia . ... S.-Petersburg, 195251, Russia. ... Institute for Problems in Mechanics of Russian Academy of Sciences . ...

Еще в разделе: (Показать все результаты (>2) - www.imec.msu.ru/ )

• EUROMECH Colloquium-458

... Mathematical models and methods in VLSI design . ... General models and statements about the complexity of combinatorial tasks, methods for development of fast algorithms (method of dynamic programming, ?divide and conquer?, ?method of model extension?) are considered. ... Mathematical models of contemporary electronic circuits are considered and basic approaches to solving task of logic synthesis, as well as tasks of VLSI modules placement and interconnection routing are described. ...

Еще в разделе: (Показать все результаты (>21) - hcs.cmc.msu.ru/ )

• Master program "Decision Engineering in Economics and Finance" | Магистерское и
• Master program "Mathematical and computer methods of image processing" |
• Master program "Mathematical Models of Complex Systems" | Магистерское и

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>47) - www.msm.biophys.msu.ru/ )

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Partners . ... All partners . ... During the round table, NAMMI and Lomonosov Moscow State University were represented by Sergey Smirnov, associate professor of the Faculty of Journalism of Lomonosov Moscow State University. ... 1999-2014 Faculty of Journalism, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>41) - www.journ.msu.ru/ )

• Full-time programs :: Department of Journalism, M. V. Lomonosov Moscow State

... новости . блог . обзоры . ... библиотека . ... о проекте . Флогистон / ключевые слова (теги) / library . ... психология и интернет . социальная психология . общая психология . клиническая психология . психология труда и инженерная психология . педагогическая психология . ... мысли о... психология и юмор . новости психологии . ... каталог психологических организаций . ... библиотека по психологии . архив учебных материалов по психологии и смежным наукам . ...

Еще в разделе: (Показать все результаты (>1237) - www.flogiston.ru/ )

The Department of Talented Youth Affairs and Professional Orientation . ... Law graduates turned in a good performance in the competition ?Foreign Direct Investment Arbitration Moot? ... November 30, 2015, an interactive roundtable meeting on ?Problems of continuous psychological and educational support of gifted children: domestic and foreign experience? was held. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>33) - talant.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• Align tool for DNA-protein complexes
• ConClus

... Astronomy search engine . ... PhysicsWeb Home Page . ... Sternberg Astronomical Institute . ... Astro Space Center Home Page . ... Landau Institute for Theoretical Physics . ... Astronomy and Space Physics Dept of Kiev University . ... NATIONAL RADIO ASTRONOMY OBSERVATORY Home Page . University of Hawaii - Institute for Astronomy . ... Space Telescope Science Institute Home Page . ... Sky & Telescope: The Essential Magazine of Astronomy . ... Springer LINK - Physics Online Library . ... Home . ...

Еще в разделе: (Показать все результаты (>156) - astro.uni-altai.ru/ )

P.G.Grinevich: List of publications 1. ... Anal. i ego Pril., 1982, v.16, No 1, pp. 19ґ24 (in russian); English translation: Funct. ... Novikov S.P., Grinevich P.G. About the spectral theory of commuting operators of rank 2 with periodic coefficients. ... English translation: Soviet Math. ... Anal. i ego Pril., 1985, v. 19, No 4, pp. 32ґ42 (in russian); English translation: Funct.Anal.Appl., 1985, v.19, pp. ... Anal. i ego Pril., 1986, v. 20, No 1, pp. 14ґ24 (in russian); English translation: Funct. ...

Еще в разделе: (Показать все результаты (>171) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/~asmish/Lichnaja-2010/Version2010-11-20/Trudy/Publications/2009/ShortCourse-2009.pdf
• http://higeom.math.msu.su/~asmish/Lichnaja-2010/Version2010-11-20/Grants/Grants_en.htm

Contamination of soils and deeper sediments by toxic metals, metalloids, and radionuclides is a worldwide problem due to improper disposal practices, spills, atmospheric deposition of combustion emissions, and intentional application of sludges, fertilizers, or other materials. ... Microbial reduction of chromate, for example, may convert highly mobile Cr(VI) to less mobile Cr(III). In other cases, changes in metal redox state may be indirectly caused by microbial activity. ...

Еще в разделе: (Показать все результаты (>11) - eco.soil.msu.ru/ )

... Ярмарка вакансий и стажировок для студентов и выпускников вузов . ... Вакансии . ... Mobile Communications Division . ... Mobile Handset (Product: Samsung Mobile Phone) . ... Designing, development, and porting of creative Mobile platform User Interface applications using GTK, Tiny-X and OpenGL ES compliant 2D / 3D Library . ... Development of GTK based applications . ... 1) Conceptual knowledge of UI frameworks, understanding of design patterns such as model-view-controller. ...

Еще в разделе: (Показать все результаты (>108) - www.physcareer.ru/ )

• Network Application Developer in Mobile Handset / Вакансии / Physcareer.ru
• Solution Centre Engineer (Graduate) / Вакансии / Physcareer.ru

Setting Up a Pay System Canada Business Service Centres - CBSCs Last Verified: 2004-05-28 Document No. 4046 Summary Pay administration is a management tool that enables you to control personnel cost, increase employee morale, and reduce work force turnover. ... This publication provides time-tested concepts for determining competitive pay levels and for maintaining fair pay relationships among the jobs comprising a small company. ... appraise employee performance under the plan. ... job title; . ...

Еще в разделе: (Показать все результаты (>23) - innovation.msu.ru/ )

• Start-Up Company Development :: Управление инновационной политики и организации

. This web page uses frames, but your browser doesn't support them.

Еще в разделе: (Показать все результаты (>28) - observ.pereplet.ru/ )

• MASTER GLOBAL ROBOTIC TELESCOPES NET
• Обсерватория

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>3) - edas2.bioinf.fbb.msu.ru/ )

• EDAS (mouse) - Alternative Splicing DataBase.
• EDAS (human) - Alternative Splicing DataBase.

NATO Publishing Unit P.O. Box 17 3300 AA Dordrecht A U T H O R 'S D A T A B A S E E N T R Y S H E E T (to be submitted together with the scientific paper ) REFERENCE: ARW978587 TITLE OF THE NATO MEETING/ NATO ASI SERIES VOLUME : Use of Humic Substances to Remediate Polluted Environments: from Theory to Practice NAME OF THE DIRECTOR: Dr. Norbert ... The total space available for keywords and abstract of your paper is 900 characters (approx. 100 words). ...

Еще в разделе: (Показать все результаты (>100) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2009/2009-kunenkov-total.pdf

Using stand-alone SDPfox . ... To add a new specificity group, type in the group name and press "Add" . To change composition of specificity groups, select two groups: first, from which to remove sequences, and second, to which to add sequences. ... For a constructed grouping, it is possible to run SDPgroup, re-randomize grouping or move sequences according to the best weights (see algorithm) under the link 'SDPgroup'. ... These sequences are likely to be re-grouped after SDPgroup is performed. ...

Еще в разделе: (Показать все результаты (>137) - bioinf.fbb.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>7) - www.msu.dubna.ru/ )

• Показ слайдов для альбома :: 40-летие Филиала МГУ
• Показ слайдов для альбома :: Школы
• Показ слайдов для альбома :: ОИЯИ

I. S. MAMAEV Institute of computer science 426034, Russia, Izhevsk Universitetskaya St., 1 E-mail: mamaev@rcd.ru NEW CASES WHEN THE INVARIANT MEASURE AND FIRST INTEGRALS EXIST IN THE PROBLEM OF A BODY ROLLING ON A SURFACE Received September 16, 2003 DOI: 10.1070/RD2003v008n03ABEH000249 Some new cases when the invariant measure and an additional first integral exist in the problem of a rigid body rolling on a sphere and on an ellipsoid are discussed in the paper. ... Rolling of a ball on a surface. ...

Еще в разделе: (Показать все результаты (>142) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/c44/129-an-integrability-of-the-problem-on-motion-of-cylinder-and-vortex-in-the-ideal-fluid_ru.pdf
• http://ics.org.ru/upload/iblock/daa/139-notes-on-diffusion-in-collisionless-medium_ru.pdf
• http://ics.org.ru/upload/iblock/d2d/196-the-dynamics-and-control-of-a-spherical-robot-with-an-internal-omniwheel-platform_ru.pdf

... Timetable of plenary lectures . Timetable of plenary lectures 17.06-22.06, 2008 . ... Demonstration of L.S. Pontryagin's lecture . ...

Еще в разделе: (Показать все результаты (>42) - pont2008.cmc.msu.ru/ )

• Program Международная конференция Дифференциальные уравнения и топология ,
• Conference Venue International Conference Differential Equations and Topology

Aleksanteri Institute Visiting Scholars Programme Aleksanteri Visiting Fellowships 2013 ґ2014 THE FELLOWSHIP Is intended for scholars who hold a PhD degree in a field relevant to the Aleksanteri Institute 's research agenda and whose place of residence i s outside of Finland Is for a period of two to three months between August 2013 and June 2014 Involves a research stay at the Aleksanteri ... An electronic application form 2. ... The applications are evaluated by three experts. ...

Еще в разделе: (Показать все результаты (>80) - www.mgubs.ru/ )

• http://www.mgubs.ru/images/Image/Aleksanteri_Visiting_Fellowships_2011-2012.pdf
• Выпуск 2/2010 | Высшая школа бизнеса МГУ им. Ломоносова
• Высшая школа бизнеса МГУ им. Ломоносова