... Faculty of Physics . ... Online journals . ... Access to the E-library is open from any computer in the intranet of the Faculty connected to the Internet. ... URL link: http://www.iop.org/EJ/ These journals can be accessed on-line from any computer in the intranet connected to the Internet. ... URL link: http://www.elsevier.com/wps/find/journal_browse.cws_home/P12?pseudotype= =Title 1Code=P12 =A These journals can be accessed on-line from any computer in the intranet connected to the Internet. ...
Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete
[
Текст
]
Ссылки http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cs.msu.su/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cmc.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011 Похожие документы
... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...
. This Page Requires JavaScript 1.1 . Your browser either does not support JavaScript, or it has JavaScript support disabled. If you want to correctly view this page, please upgrade your browser or enable JavaScript support.
http://www.famfamfam.com/lab/icons/silk/ . Silk? is a smooth icon set, containing 1000 16-by-16 pixel icons in strokably-soft PNG format. ... And all for a low low price of $0.00. ... I also love to hear of my work being used, feel encouraged to send an email with a link or screenshot of the icons in their new home to mjames at gmail dot com. ... All I ask is that you include a link back to http://www.famfamfam.com/lab/icons/silk/ in your credits (contact me to discuss licencing further). ...
About BAFIZ . BAFIZ at SINP MSU . Bafiz' Information Resources at SINP . ... Information Services . ... Space Physics Information Home Page . The Centre for Photonuclear Experiments Data (Centr Dannykh Fotoyadernykh Eksperimentov, CDFE)" . Data Services . Data Base of Low Altitude Space Radiation Environment (DB LASRE SINP MSU) . Space Physics Data Archives . Space Physics Data On-Line Services . ... This Page is developed at Laboratory of Computational Mathematics, . ...
Russian abstract] . Russian full text] . The classifications revealed by geometric morphometry and classical morphometry for Drosera rotundifolia , D. obovata , D. anglica and D. linearis were compared. ... the form of petiole middle part transverse section is the effective distinguishing character for the some different species and inter-species hybrids of Drosera ; . the consensus configurations are preferable for the geometric morphometry analysis of populations. ...
... Key words: Mathematical physics, algebraic geometry, quantum groups. ... Major research position at the Higher geometry and topology department of MSU(from 2009) Doctor habilitatus degree in physical-mathematical sciences Адрес: 119991 ГСП-1, г. Москва, Ленинские горы, МГУ, механико-математический факультет, кафедра высшей геометрии и топологии e-mail: dtalalaev@yandex.ru тел: (495) 939 3798 Текущие научные проекты: Семинар по некоммутативной геометрии (ИТЭФ). ... Семинар ИТЭФ . Семинар МГУ . ...
... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...
The Department of Talented Youth Affairs and Professional Orientation . ... Older posts . Posted on 09.11.2015 by admin . ... The team competitions Continue reading . Posted in News , Без рубрики | Leave a comment . ... In the 2015/16 Continue reading . ... The festival is organized by the Department of Continue reading . ... Posted on 17.11.2014 by admin . ... Federal Agency for Youth Affairs ?Rosmolodezh?, ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...
GENERAL INFORMATION . Administration . Organization Division . Information Division . ... Scientific Council D 053.05.76 . The Prof. Ilya Berezin Foundation . Postgraduate Students . Students . ... Scientific Subdivisions | ... 1998-1999 Chemical Enzymology Department, Chemistry Faculty . ... Back . ...
... If you have already registered, please fill in you login and password in the form below main menu (leftmost column). ... If something goes wrong (for example, you've been registered by site andministrator and don't have password at all or you just forgot it), please contact site administration by E-mail dubna2007@biophys.msu.ru . ... If you are warned that you've already registered please contact site administration by E-mail dubna2007@biophys.msu.ru to get access to your Personal Office . ...
... Ярмарка вакансий и стажировок для студентов и выпускников вузов . ... Вакансии . ... Learning and Understanding HP and 3rd party software solutions, including architectures, development practices, frameworks, methodologies, SDK's, additional programming languages and tools as necessary, etc . ... Development of test plan, unit tests, integration, system and acceptance tests, basing on functional specification and user requirements, architectures, development schedules and project plans . ...
MultiTest V.1.2, a program to binomially combine independent tests and performance comparison with other related methods on proportional data Thierry De MeeШs1,2*, Jean-FranГois GuИgan2 and Anatoli Teriokhin3 1 IRD, UMR 177 IRD-CIRAD "Trypanosomoses", Centre International de Recherche-DИveloppement sur l'Elevage en zone Subhumide (CIRDES), 01 BP 454, Bobo-Dioulasso 01, Burkina-Faso. ... All procedures more or less behaved consistently with ~5% significant tests at ?= ... and number of species in | ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2009_Bonferroni_deMeeus.doc -- 360.0 Кб -- 11.08.2009 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... GOES corrected results are wrong, because the publication Smart D.F. and M.A. Shea, Comment on the use of GOES solar proton data and spectra in solar dose calculations, Radiation Measurements 30 (1999) 327-335 was erroneous (see "The issues...." above. ... The criticism of the use of the log-normal distribution for the data fit in Feynman et al. is excessive. Indeed, Feynman et al. use only the high intensity part for the fit making the results almost independent of the low energy part. ...
системы автоматизации, автоматизированные системы , информационные системы , мобильные и встраиваемые системы , программное обеспечение, вычислительные системы , средства связи,базы данных, информационные технологии,технологии программирования, обработка изображения, параллельные вычисления, информационное моделирование,математическое моделирование, вычислительный эксперимент, информатика,методы вычислений, численный анализ, numerical ...
... T. A. Dolenko, S. A. Burikov, K. A. Laptinskiy, and O. E. Sarmanova, Improvement of the fidelity of molecular DNA computations: control of DNA duplex melting using Raman spectroscopy, Laser Physics, v. 26, No 2 Jessica M. Rosenholm, Igor I. Vlasov, Sergey A. Burikov, Tatiana A. Dolenko, and Olga A. Shenderova. ... A.O. Efitorov, S.A. Burikov, T.A. Dolenko, I.G. Persiantsev, S.A. Dolenko. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...
BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...
... Faculty of Physics . ... Research Centers . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...