... Head of the seminar: Prof. B.V. Somov, . ... The seminar considers the questions related to generation of magnetic fields in astrophysical plasmas, effect of the magnetic reconnection and particle acceleration in strong magnetic fields, the origin and propagation of cosmic rays, the flares and other non-stationary phenomena in the solar atmosphere and solar wind, Sun Earth connections and physical processes in the heliosphere. ... On the Topological Models and Topological Trigger of the Solar Flares...

Еще в разделе: (Показать все результаты (>3) - sun.sai.msu.ru/ )

Lomonosov project . ... Mikhail Lomonosov . ... The studies of Lomonosov determined profile of Russian science forever, and we appreciate the discoveries of the leading Russian scientists as the studies of his direct learners and successors. A recognized and the most significant input of Lomonosov into natural science is molecular-kinetic theory of heat, developed during the prevalence of theory of specific fiery matter ? ... Lomonosov?s theory drawn wide response in European science. ... Aurora. ...

Еще в разделе: (Показать все результаты (>10) - lomonosov.sinp.msu.ru/ )

V.A. Khokhlova, M.R. Bailey, P.J. Kaczkowski, B.W. Cunitz, J. Reed, M. Nakazawa, and L.A. Crum. ... V.A. Khokhlova. ... O.A. Sapozhnikov, R. Cleveland, M.R. Bailey, L.A. Crum. ... V.A. Khokhlova, M.A. Averkiou, M.A. Bailey, and L. A. Crum. ... V.A. Khokhlova, P.J. Kaczkowski, B.W. Cunitz, M.R. Bailey, and L.A. Crum. ... In: Book of Abstracts of the, 3.32B. V.A. Khokhlova, M.A. Averkiou, A.E. Ponomaryov, L.A. Crum. ... A.E. Ponomaryov, V.A. Khokhlova, M.A. Averkiou, and L.A. Crum. ...

Еще в разделе: (Показать все результаты (>25) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/photos/achievements/asa_2013.pdf
• http://acoustics.phys.msu.su/links.htm
• http://acoustics.phys.msu.su/conf2002.htm

... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...

Еще в разделе: (Показать все результаты (>2) - depni.sinp.msu.ru/ )

Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...

Еще в разделе: (Показать все результаты (>4) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~sveta/SDN_OpenFlow_controllers_lecture2.pdf

... About hotel . ... New laundry. In hotel there is a laundry for convenience of guests. 22.08.2013 12:20 . Renewed website. The hotel т??69th Parallelт?? is glad to present its renewed website which now has an option of online booking! ... The system of online booking of our site will help you quickly and with guarantee directly to reserve any room both with an advance payment, and with possibility of payment at arrival. ... Reception: +7(8152) 253-700 . 7 (8152) 253-700 . ...

Еще в разделе: (Показать все результаты (>2) - 69parallel.ru/ )

• Hotel "69 Parallel" - New laundry.

... А.А. Данилова . ... Мониторинг СМИ . ... Библиотека : Публикации сотрудников кафедры : А.А. Данилова . Косово 1999, или об одном приеме манипулирования сознанием в СМИ . Автор Данилова А.А. Nov 21, 2007, 12:31 . ... Один из самых примечательных способов воздействия на сознание в СМИ - прием, который мы назовем персонализацией-овеществлением. ... Serb troops have continued attacks on unarmed men, women and children [5] ( англ .) ... Ни в одном выпуске еженедельника Newsweek за 1999 г . ...

Еще в разделе: (Показать все результаты (>6) - genhis.philol.msu.ru/ )

... 1998, 64; .: ... C» « -- »; « », , «», -- 1913 . 1914 .6 , , , . ... Gleichnis «» [Livingstone 199 0, 106; 1993, 91; c. : , 29­30, . ... Materia prima», -- («Ballade», «Complainte du pauvre corps humain» [Laforgue 1970, 229; 1989, 591­592; , 180]). ... 1977, 62­101; 1979 , ; 1998; Fleishman, 59­83; . ... 2004. ... 2000 ; : 1998 , 59­65; Guntermann, 244­245]; , , , . ... 1997 -- // BeitrДge zum Internazionalen Pasternak Kongreъ 1991 in Marburg. ... Paris, 1979: 19­42. ... Paris, 1979: 289­301. ...

Еще в разделе: (Показать все результаты (>10) - imk.msu.ru/ )

• Vyach. Vs. Ivanov. Institute of World Culture

МИЗОТИН Максим Михайлович старший преподаватель кандидат физ.-матем.наук: 2009 МГУ контакты: mizotin@cs.msu.su СЕМИНАРЫ: Обыкновенные дифференциальные уравнения 3-4 семестры, 2 курс Уравнения математической физики 5 семестр, 3 курс, 2 поток НАУЧНЫЕ ИНТЕРЕСЫ: математические методы обработки изображений методы обработки и анализа экспериментальных данных методы регуляризации математическое моделирование ПУБЛИКАЦИИ: A. S. Krylov, M. M. Mizotin. ... 22, No. 6, 2011, pp. ... Inorganic Materials, 2009, Vol. ...

Еще в разделе: (Показать все результаты (>2) - mph.cmc.msu.ru/ )

... Камерный оркестр МГУ . ... http://blankov.narod.ru - информация о старинной музыке, ее исследователях и интерпретаторах . http://www.dk.msu.ru - . ... http://www.rbsp.org/EMLinks/ - Общество R&B - коллекция сайтов по старинной музыке . ... http://classicalmus.interspeed.net/earlyperf.html - Старинная музыка - солисты и ансамбли . http://classicalmus.interspeed.net/early/index.html - Старинная музыка в Интернете . ... http://www.medieval.org/emfaq/ - Старинная музыка (FAQ) . ...

Еще в разделе: (Показать все результаты (>4) - music.genebee.msu.ru/ )

• MSU Chamber Orchestra. Links to some "baroque" sites.

... Сайт физического факультета . Неофициальный студенческий сайт факультета . ... Сайт библиотеки физического факультета . Список online изданий с доступом через физический факультет (в том числе SCOPUS, elibrary, Springer и др.) ... Lightwave Russian Edition 2003 . Lightwave Russian Edition 2004 . Lightwave Russian Edition 2005 . Lightwave Russian Edition 2006 . Lightwave Russian Edition 2007 . Lightwave Russian Edition 2008 . ...

Еще в разделе: (Показать все результаты (>2) - opts.phys.msu.ru/ )

... Магистерское образование . ... Enterprise Information Infrastructure . This course is focused on enterprise infrastructure and integration technology. Course presents different approaches to enterprise architecture and modern solutions of information infrastructure problems. Course?s topics cover strategies that help large enterprises to increase the agility of their IT systems. ... Enterprise portal technology, including collaboration and knowledge management . ... FI- Master data . ...

Еще в разделе: (Показать все результаты (>4) - hcs.cmc.msu.ru/ )

• Mathematical models and methods in VLSI design | Магистерское и послевузовское
• Master program "Information Security and Cryptography" | Магистерское и

CUDA Center of Excellence NVIDIA 22 « » ­ NVIDIA HPC Day. NVIDIA, , . Wen-mei W. Hwu (), , . 9:30 -- 10:00 10:00 -- 11:30 The Future of GPU computing Prof. Wen-mei W. Hwu 11:30 -- 12:00 Introducing Kepler: new generation GPU architecture Mark Ebersole , , 12:20 -- 13:20 , .. , .. , .. , .. 13:20 -- 15:00 GPU CUDA Prof. Wen-mei W. Hwu - « » : 2- , . 238 : http://ccoe.msu.ru

Еще в разделе: (Показать все результаты (>4) - ccoe.msu.ru/ )

• OpenACC: Вычисления на GPU с помощью простых директив | GPU Center of

Converters . A converter from ASCI GRD (Surfer, Golden Software Inc.) files into IPI data format. A converter from Res2dInv and IRIS SysCal files (Windows) . ... Runtime Error 200 - 'Divide by 0' on fast PCs. ... The cause of this error is a bug of Borland Pascal 7 . Now we found the way to solve this problem (on page "Fix for Borland Pascal" ). ... 119899, Russia, Moscow, Moscow State University, Geological Faculty, Department of Geophysics, Bobachev Alexei . ...

Еще в разделе: (Показать все результаты (>13) - geophys.geol.msu.ru/ )

... О проекте . ... A specialized source of quasi-?monochromatic X-?ray radiation for medical application is proposed. It includes two electron storage rings (E = 50 MeV) placed in the vertical plane and two laser resonators located in the horizontal and vertical planes. Hard X rays are generated in a process of back Compton scattering of laser photons ~1eV by electrons in the linear paths of storage rings. ...

Еще в разделе: (Показать все результаты (>7) - miles.sinp.msu.ru/ )

• Proposal of a Compact Repetitive Dichromatic X-ray Generator with Millisecond

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... Surface disturbance and deformat ion are shown in the same scale. Displac the free surface is much smoother as compared bottom deformations: init ial elevat ion has amplitude and spreads over a rather wide area. bottom theory, bottom ement of with the smaller F ­ velocity potential, H ­ depth, ­ vector of bottom deformation, 0 ­ initial elevation a . ... The init ial elevation assumed to be equal to the vertical bottom deformat ion (a); calculated with use of the Laplace smoothing algorithm (b). ...

Еще в разделе: (Показать все результаты (>14) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/pubs/Chashechkin-Waves.pdf
• http://ocean.phys.msu.ru/science/nosov/EGU2010_pumping.pdf

The file a_news.php had been edited by : IP: 193.232.121.99 Time: 22.12.2008|12:28:34 This message had been generated by http://www.web2ftp.com On abuse issues, please contact abuse@web2ftp.com

159. http://danp.sinp.msu.ru/Articles_GSIB/nimb206_902_Yamada_largeClasterIonCurrent.pdf

160. http://curl.sai.msu.ru/mass/download/doc/infrasoft_eng.pdf