... He was graduated from Moscow State University, Faculty of Mechanics and Mathematics, and post-graduate course in a speciality Theory of Probabilities and Mathematical Statistics. ... Ph.D in mathematics in 1980 (Moscow State University, Faculty of Computer Science). ... Author of Popular Textbooks on Data Analysis and Statistics. ... He was graduated from Moscow State University in 1980. Ph.D in mathematics in 1988 (Moscow State University, Faculty of Mechanics and Mathematics). ... InCo . ...

Еще в разделе: (Показать все результаты (>2) - statsoft.msu.ru/ )

Irena Lasiecka ( University of Virginia ) . Nikolai Melnikov (CEMI / MSU) . Mikhail Zelikin (MSU / Steklov Institute) . G. Avalos ( University of Nebraska , USA ) . V. Borisov (MSU, Moscow) . ... O. Emanouvilov ( Colorado State University , USA ) . A. Fursikov (MSU, Moscow) S. Hansen ( Iowa State University , USA ) R. Hildebrand ( Joseph Fourier University , France) V. Komornik ( University of Strassburg, France ) A. Kowalewski ( Institute of Automatics, Poland ) . ... Moscow) . ...

Еще в разделе: (Показать все результаты (>2) - oc.cs.msu.su/ )

... Control of the Frequency Spectrum of a Biphoton Field Due to the Electro Optical Effect K. G. Katamadzea, A. V. Paterovaa, E. G. Yakimovab, K. A. Balyginc, and S. P. Kulik a b a Faculty of Physics, Moscow State University, Moscow, 119992 Russia Institute of Physics and Technology, Russian Academy of Sciences, Nakhimovskii pr. ... Akademika Kurchatova 1, Moscow, 123182 Russia Received June 29, 2011 A method for controlling the spectrum of spontaneous parametric down conversion has been implemented. ...

Еще в разделе: (Показать все результаты (>94) - qi.phys.msu.ru/ )

• http://qi.phys.msu.ru/papers/2011-pra-83-060302(R).pdf
• http://qi.phys.msu.su/papers/2008-jetpl(e)-87-60.pdf
• http://qi.phys.msu.ru/kulik/Papers/JETLetters_Kalashnikov08.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Comparison of protein phylogeny reconstruction methods

... Home News Colloquium on 07.12.12 . Date :љDecember 07, 2012 . ... Sultan Itenkenov љ (scientific advisor Dr. Alexey Voskov ) . DaryaљKosova љ (scientific advisor Dr.љ Anna Emelina ) . ... Colloquium on 24.12.12 20 Dec 2012 . ... Colloquium on 23.11.12 22 Nov 2012 . ... Colloquium on 19.10.12 15 Oct 2012 . Lomonosov Moscow State University . Department of Chemistry . ... Laboratory of Chemical Thermodynamics . ... 2000-2016 Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>92) - td.chem.msu.ru/ )

• Colloquium on 14.12.12 Laboratory of Chemical Thermodynamics
• Colloquium on 23.12.11 Laboratory of Chemical Thermodynamics
• Colloquium on 26.11.09 Laboratory of Chemical Thermodynamics

... MSU Chamber Orchestra . Concerts of . ... 1999/2000 season: . MOSCOW . ... German Music of XVII c. Johann ROSENMULLER (1620 - 1684) . ... Leontyevsky pereulok, 6 (metro station "Arbatskaya" or "Pushkinskaya") . ... MSU Chamber orchestra . ... Ulitsa Fadeeva, 4 (metro station "Mayakovskaya") . ... Big Hall of Moscow State University (the building at Vorobievy Gory) . ... MSU CHAMBER ORCHESTRA . ... The tickets are in the Moscow State Philarmony office . ... Big Hall of Moscow State University . ...

Еще в разделе: (Показать все результаты (>7) - music.genebee.msu.su/ )

• MSU Chamber Orchestra. Concerts. Season 2000/2001.

... Department of Mathematical Physics . ... Springer: Журналы . Springer: Книги . ... Журнал Science . ... Журналы American Physical Society . ... Журналы NPG (Nature Publishing Group) . ... Журналы The American Mathematical Society . Журналы The Royal Society Publishing . ... The Royal Society Publishing (GreatBritain) . ... the Royal Society A: Mathematical, . ... the Royal Society B: Biological Sciences . Proceedings of the Royal Society A: Mathematical, Physical & Engineering Sciences . ...

Еще в разделе: (Показать все результаты (>53) - mph.cmc.msu.ru/ )

... GnuGeneralPublicLicense 3 - 2004-08-15 - PeterThoeny . ... TWiki has a GPL (GNU General Public License). What is GPL? ... This program is open source software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. ... See the GNU General Public License for more details, published at http://www.gnu.ai.mit.edu/copyleft/gpl.html . ...

Еще в разделе: (Показать все результаты (>28355) - dualopt1.cmm.msu.ru/ )

• GnuGeneralPublicLicense - TWiki - TWiki - (printable)
• %TOPICTITLE% (19 vs. 20) - TWiki
• ChangeEmailAddress - TWiki - TWiki

Faculty of Physics of Lomonosov Moscow State University . ... Department of Photonics and Microwave Physics is one of the largest departments of Faculty of Physics of Lomonosov Moscow State University . ... Our department holds annual conference on wave phenomena in nonhomogeneous media, physics and applications of microwaves in May in Moscow suburb. ... Physics of microwaves . ... Department of Photonics and Microwave Physics . Faculty of Physics . Lomonosov Moscow State University . ...

150. About the CCOE at Lomonosov Moscow State University | CUDA Center of Excellence

151. English - Кафедра иудаики ИСАА МГУ