... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...
... These approaches were: (1) laser photobleaching of a path through the centrosome; (2) direct observation of microtubules in centrosome-containing cytoplasts; (3) GFP-CLIP-170 expression as a marker for microtubule plus end growth; and (iv) sequential subtraction analysis. ... This result signifies that most MTs persistently grow from their time of birth at the centrosome until their plus end nears the cell margin. ... Growth of nascent MTs in CHO cells was not only persistent but rapid. ...
[
Текст
]
Ссылки http://cellmotility.genebee.msu.ru/html/articles/komarova2002.pdf -- 696.8 Кб -- 18.09.2002 Похожие документы
... The optimal control, which led oscillatory system to a certain energy level from any initial conditions at minimum time, is found. ... A set of points where the trajectory becomes an arc of a circle with the other center is called the switching line. ... For drawing switching line near the origin (see for example Figure 3) we note from the system (1) that time is proportional to the sum of the angles 214 this sums for optimal and quasi-optimal processes. ... The control function (14) is not optimal....
THE JOURNAL OF CHEMICAL PHYSICS 133, 144101 2010 Effective numbers of modes applied to analysis of internal dynamics of weakly bound clusters A. A. Rybakov,a E. D. Belega, and D. N. Trubnikov Department of ... Russia Received 11 June 2009; accepted 14 September 2010; published online 11 October 2010 The dependence of the volume of the chaotic component in the internal dynamics of triatomic van der Waals clusters on the angular ... When such difference is small, the regular motion disappears. ...
... Геология >> Геохимические науки | Курсы лекций . ... Беус А. А. Геохимия литосферы. ... Труды по геохимии. ... Проблемы геохимии и космохимии. ... М.: Наука, 1983. 159 с. Гриненко В. А., Гриненко Л. Н. Геохимия изотопов серы. ... Кепежинскас В. В., Гладких В. С. Геохимия кайнозойских вулканических пород Монголии //: Проблемы петрологии земной коры и верхней мантии: Тр. ... Барсуков В.Л., Волков В.П. М.: Наука, 1989. 478 с. Ронов А. Б., Ярошевский А. А. Химическое строение земной коры // Геохимия. ...
... CENTRE FOR PHOTONUCLEAR EXPERIMENTS DATA . Online Services | ... ONLINE SERVICES. ... G E N P D T H3 A HE3 HE4 LI6 C12 O16 O17 O18 S32 AR40 TI48 BRST BRST-POL MON MON-POL POL . ... CDFE Head : Vladimir V. Varlamov . ...
. Sites . Remove access privilege . You can remove yourself from the Owner, Collaborator, or Viewer list from this site by clicking the "Remove Access" button. Once access is removed it can not be undone by yourself. Remove access . Cancel
... 2013 тАФ Academic Writing: Russian and International Experience (Moscow) . ... 2009 тАФ Media Imagination (Moscow) . 2008 тАФ University Among the Media: Innovation in Higher Learning and Changing Modes of Effective Communication (Moscow) . ... 2003 тАФ Reading Everyday Life in American and in Russian: Semiotics of Culture and Intercultural Communication (Yasnaya Polyana) . 2002 тАФ Popular Literature: American and Russian Experience in Cultural Myth-Making (Moscow) . ... Summer School 2016 . ...
... Web portal on atmospheric environment is developed by international consortium as a be-lingual information resource in area of atmospheric physics and chemistry and in related domain air quality assessment and management. ... The portal has all typical component and services like collections of links, user group registration, discussion forum, etc. ... Each scientific site is an information-computational system designed in Internet technologies. ... 00189 138. ... 2003 . ... 2002, 252 . ...
... We also prove some a generalization of the KauffmanMurasugiThistlethwaite theorem on "minimal diagrams" for graph-links. ... Virtual trefoil. ... Introduction to Graph-Link Theory 799 Conversely, having a connected virtual diagram K (with at least one classical crossing) with oriented atom, one can get a labeled chord diagram. ... We conjecture that the graph-link represented by BW3 has no "realizable" representatives which correspond to classical or virtual diagrams via chord diagrams. ...
[
Текст
]
Ссылки http://dfgm.math.msu.su/files/0articles/Ilyutko/ilyutko-JKTR.pdf -- 418.6 Кб -- 21.08.2009 Похожие документы
Научно-образовательный центр Геномного секвенирования МГУ . ... Sep 11, 2014, 9:17 AM . Yegor Bazykin attached NGS_supported_list.pdf to Результаты конкурса NGS-проектов . ... Yegor Bazykin deleted attachment NGS_supported_list.pdf from Результаты конкурса NGS-проектов . ... Yegor Bazykin edited Конкурс NGS-проектов . ... Yegor Bazykin created Результаты конкурса NGS-проектов . Jul 5, 2014, 2:53 AM . Yegor Bazykin updated polozhenie.pdf . ... Recent Site Activity | ...
... Individual SELEX products, aptamers, are small molecules (40100 nt) that have a unique three-dimensional structure, which provides for their specific and high-affinity binding to targets varying from low-molecular-weight ligands to proteins. ... Selection of aptamers binding with a target is the key step in SELEX, as aptamers account for only a small fraction of the initial library (one aptamer per 109 to 1013 molecules) [6]. ... Fourth, modification can increase the aptamer affinity for a target. ...
[
Текст
]
Ссылки http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf -- 375.6 Кб -- 21.10.2002
[
Текст
]
Ссылки http://rnp-group.genebee.msu.ru/pages/pdf/molbio2000.pdf -- 375.6 Кб -- 18.02.2008 Похожие документы
ISTITUTO NAZIONALE DI FISICA NUCLEARE Sezione di Genova INFN/TC-08/02 23 June 2008 STUDY OF THE RESPONSE OF THE NEMO-KM3 DETECTOR INSTRUMENTED WITH DIRECTION-SENSITIVE OPTICAL MODULE M. Anghinolfi1 , M. Bersani1 , K. Fratini1 , V. Kulikovsky2, M. Osipenko1, A. Plotnikov2, E. Shirokov2, M. Taiuti1 , S. Zavatarelli1 ... Physics, Moscow State University, 119899 Moscow, Russia Abstract We studied the performances of the underwater neutrino telescope NEMO-KM3 ...
This domain may be for sale - этот домен возможно продается . ... The gathered information about your visits to this and other websites are used by these third party companies in order to provide advertisements about goods and services of interest to you. ... If you would like more information about this practice and to know your choices about not having this information used by these companies, click here . ...
A GENETIC ALGORHYTM FOR OPTIMIZING A NEURAL NETWORK CAPABLE TO LEARN FOR FOOD SEARCHING IN A RADIAL MAZE Budilova E.V., Chepurnova N.E., Chepurnov S.A, Teriokhin A.T. M.V.Lomonosov Moscow State University, Dept. of Biology. ... The upper platform has a hole in the middle and several radially directed tubular canals ("arms") each of which can contain a peace of food and has doors opening only in the centrifugal direction. ... The task of the animal is to visit only those arms which contain food. ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2001_RadialMaze.doc -- 28.0 Кб -- 16.03.2009 Похожие документы
. Deprecated : mysql_connect(): The mysql extension is deprecated and will be removed in the future: use mysqli or PDO instead in /wcmc/lms/lms/includes/database.mysql.inc on line 31 . Warning : mysql_connect(): Can't assign requested address in /wcmc/lms/lms/includes/database.mysql.inc on line 31 . Can't assign requested address
... The linguistic aspects of the model and the properties of the semantic dictionary ensuring the content analysis with compression of the text structure are considered. Our dictionary resources serve an instru- ment for building a multilevel textual semantic structure. ... Reason (A,B), where SemF(A) = SIT or a whole semantic formula; the same for SemF(B). ... Sem(SIT)R . ... Semantic Resources for Textual Content Compression // Fourth International Conference on Meaning-Text Theory (MTT'09). ...
... Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mechmath faculty admission resumed its work and is actively preparing for the new reception 2015! ... Read more about Schedule in June . ... The Dean of Mechanics and Mathematics Faculty, the head of the Department of Mathematical and Computer Analysis Methods, professor Vladimir Chubarikov ; . ... Read more about The Open Day . ... 2016 Mechmath admission for internetional students ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Science . ... 15:00 S.A. Akhmanov Hall, Nonlinear Optics Bld. ... Home Science and education Scientific Laboratories Laboratory of nonlinear polarization optics . ... The mechanisms of evolution of polarization during radiation propagation in nonlinear media with nonlocality of optical response. ... As a result, a new field of science has originated, the nonlinear polarization optics, providing new insights into the interplay of polarization effects in classic nonlinear optical processes. ...