News of PARALLEL.RU par-news на mail.parallel.ru . ... Разработка грид-сервиса управления заданиями ГридННС Pilot на основе архитектурного стиля REST . http ://agora.guru.ru/parallel ------------- НОВОСТИ МИРА ВЫСОКОПРОИЗВОДИТЕЛЬНЫХ ВЫЧИСЛЕНИЙ http :// parallel.ru / news / + Intel представляет секцию параллельное программирование конференции TechDays.ru. http ://www.techdays.ru/category/21.html + Georgia Institute of Technology создает Institute for Data and High Performance Computing ...
... структурная морфология растений, морфология цветка, теоретическая ботаника, биотехнология (клональное микроразмножение in vitro ). ... Чуб В.В. 'Роль позиционной информации в регуляции развития органов цветка и листовых серий побегов'. ... Чуб В.В., Юрцева О.В. Математическое моделирование формирования цветка у представителей семейства Polygonaceae. ... Choob V.V., Penin A.A. Structure of Flower in Arabidopsis thaliana : Spatial Pattern Formation// Russian Journal of Developmental Biology (Ontogenez...
... Scheme of main supposed ways of energy deactivation in the PSI of thermophilic cyanobacteria upon heating above 60 o C. Reactions activated and suppressed during heating are marked by thick and dotted lines, respectively. Carotenoids are inactivated upon heating to 60 o C (reaction 1). Heating from 60 to 80 o C gradually inactivates forward electron transport to iron-sulfur clusters of [4Fe-4S] type (reaction 2) and further electron transfer to ferredoxin and oxygen (reaction 3). ...
... Жизнь факультета . ... The course will include clinical cases and lectures on general cardiology and additional knowledge of interventional cardiology, cardiovascular imaging (echocardiography, cardiac CT, CMR, nuclear and PET scan), cardiovascular intensive care, electrophysiology and device therapy, advanced heart failure and transplantation, cardiac rehabilitation and prevention, grown-up congenital heart disease (GUCH), genetic and regenerative cell treatment of cardiovascular diseases. ...
... All Authors Title Abstract Index terms Full Text . ... Home > ICONO/LAT 2016 > 2014 International Conference on Laser Applications in Life Sciences > About the Conference > Submissions . ... All URL addresses in the text (e.g., http://pkp.sfu.ca ) are activated and ready to click. ... If submitting to a peer-reviewed track of the conference, authors' names are removed from submission, with "Author" and year used in the bibliography and footnotes, instead of authors' name, paper title, etc. ...
Использование метода симультанного осаждения для удаления фосфатов при очистке сточных вод в процессе с активным илом. ... В предыдущих публикациях представлены результаты исследований в лабораторных и полупромышленных условиях, их целью являлось получение экспериментальных данных, при этом исследовалась схема удаления из сточной воды фосфора при одновременном использовании биологического процесса и осаждения с применением смеси FeCl[2]-FeCl[3]. ...
Department of Physics, Lomonosov Moscow State University . Laboratory "Сryoelectronics" . Laboratory of Cryoelectronics (LCE) was established in the beginning of 1988 on the base of scientific group of Prof. Konstantin K. Likharev originated in 70-th at Physics Department of Moscow State University. ... As it was circumstantially formed, two organizations equipped our laboratory: the Physical Department of MSU and the section of Microelectronics of SIMP (NIIYaF) MSU. ...
The beamer class Manual for version 3.06. \begin{frame} \frametitle{There Is No Largest Prime Number} \framesubtitle{The proof uses \textit{reductio ad absurdum}.} \begin{theorem} There is no largest prime number. \end{theorem} \begin{proof} \begin{enumerate} \item<1-| alert@1> Suppose $p$ were the largest prime number. \item<2-> Let $q$ be the product of the first $p$ numbers. \item<3-> Then $q+1$ is not divisible by any of them. \item<1-> Thus $q+1$ is also prime and greater than $p$.\qedhere
... An extended set of observables of the nuclear quasi-free (p, d + ) reaction including the triple differential cross-section for coincidence measurements, its analyzing power in case of polarized proton beams and, also, the parameters of the polarization of the excited recoil nucleus and the produced deuteron are considered in the framework of the distorted-wave impulse approximation using the reaction 16 O(p, d + )15 N at a proton energy of 650 MeV as an example. ...
[
Текст
]
Ссылки http://np-chair.sinp.msu.ru/download/epja100510-offprints.pdf -- 426.2 Кб -- 18.03.2015 Похожие документы
... Linguistic expeditions . ... The expeditions worked in different villages with Selkup, Ket, Evenki, and Forest Nenets population of the Pur and Krasnoselkup districts of the Yamalo-Nenets autonomous area, and of the Turukhansk and Evenki districts of the Krasnoyarsk Territory. The expeditions were supported by Russian Foundation for Basic Researches and Russian Foundation for the Humanities. ... Students of Russian State University for the Humanities took part in the expedition. ...
Apache2 Ubuntu Default Page . It works! This is the default welcome page used to test the correct operation of the Apache2 server after installation on Ubuntu systems. ... Ubuntu's Apache2 default configuration is different from the upstream default configuration, and split into several files optimized for interaction with Ubuntu tools. ... The configuration layout for an Apache2 web server installation on Ubuntu systems is as follows: /etc/apache2/ |-- apache2.conf | ... Document Roots . ...
Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete
[
Текст
]
Ссылки http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cs.msu.su/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cmc.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011 Похожие документы
... Данный раздел информационного портала посвящен основным конференциям по тематике ПЛИС, проходящим как в мире, так и в России. FPGA 2010 - Eighteenth ACM/SIGDA International Symposium on Field-Programmable Gate Arrays. ReConFig'09 - 2009 International Conference on ReConFigurable Computing and FPGAs. ИКТМР-2009 . ... 2009 Symposium on Application Accelerators in High-Performance Computing (SAAHPC'09) . RAW 2009 . ... 5th International Workshop on Applied Reconfigurable Computing. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
ДД PROCEEDINGS OF THE 31st ICRC, LODZ 2009 1 Preliminary Proton and Helium Spectra from the CREAM-III Flight Y. S. Yoon , H. S. Ahn , T. Anderson, L. Barbier?, ... Keywords: CREAM; energy spectra; protons and helium nuclei I . ... CREAM-III I N S T RU M E N T A N D F LIGHT The CREAM-III instrument consisted of a tungsten/scintillating fiber calorimeter, a dual layer Silicon Charge Detector (SCD), a Cherenkov Camera (CherCam), a Cherenkov Detector, and a Timing Charge Detector (TCD). ...
General Information . News . Organizing Committee . ... Registered participants . Symposium expenses . ... Presentation information . ... Travel information . Contact information . 14 European Symposium on . Gas Phase Electron Diffraction . ... Participants interested in ordering a taxi to travel from airports to MSU and back are welcome to send appropriate requests to the Organizing Committee by using the email address in the Contact Information. ...
Economic, industry and corporate trends A report from the Economist Intelligence Unit sponsored by Cisco Systems Foresight 2020 Economic, industry and corporate trends Contents Preface Executive summary Chapter 1: The world economy Chapter 2: Industries Automotive Consumer goods and retailing Energy Financial services Healthcare and pharmaceuticals Manufacturing Public sector Telecoms Chapter 3: The company Appendix I: Survey results 2 3 6 22 24 30 36 43 50 57 62 67 74 86 Appendix II: Methodology for
[
Текст
]
Ссылки http://bc.fdo.msu.ru/Nik_s/WorkFiles/DOC_files/World_shares_foresight_2020.pdf -- 425.8 Кб -- 20.03.2012 Похожие документы