INTERNATIONAL CONFERENCE . February 26 - March 05, 2006, Moscow, Russia . ... Moscow State University . Institute of Mechanics of MSU . ... It follows the tradition of biannual confer-ences organized by the Institute of Mechanics of Moscow State University between 1976 and 2004 (see http://hit2003.narod.ru/ ), which were widely attended by scientists and students from the former Soviet Union. ... Phone, E-mail and Fax. ... Institute of Mechanics, Moscow State University . ...

Еще в разделе: (Показать все результаты (>22) - hit-conf.imec.msu.ru/ )

• Nonlinear Problems of Gydrodynamic Stability Theory
• Untitled

Teaching Experience . Current lecture topics: Introduction in modern problems of Dynamical Systems Theory . ... Methods of Mathematical Physics (2003-2009) . Introduction in Theoretical Physics (topics in Statistical Physics of Networks) (2006-2009) . ... Theoretical Physics (Classical Mechanics, Quantum Mechanics, Statistical Mechanics, Electrodynamics) (2000-2005) . Experience as a supervisor of PhD studies: 2 PhD are defended under my surevision; 2 PhD students recently. ...

Еще в разделе: (Показать все результаты (>66) - chaos.phys.msu.ru/ )

Theoretical problems of electrical double layer structure on ideally polarized electrodes and reversible adsorption of ions and neutral organic molecules on electrodes are considered, and also the specific features of kinetics of multistage electrochemical processes limited by mass transfer, electron transfer and chemical reaction. ... Acta, 1997, V.42, P.737. ... 1997, V.33, N 10. ... 1997, V.33, N 11. head@elch.chem.msu.ru . ...

Еще в разделе: (Показать все результаты (>37) - www.elch.chem.msu.ru/ )

• Molecular aspects of solid state and interfacial electrochemistry

Software Protection: How to Crack Programs, and Defend Against Cracking" In the first part of this course we will learn how to "crack" programs, i.e.how hackers break into software to extract secrets, remove license checks, etc. ... Learning about this type of computer security is important because many current systems are vulnerable to cracking attacks. ... The course will have practical homework exercises where you will crack small programs, and use tools to protect against cracking. ...

Еще в разделе: (Показать все результаты (>4) - master.cmc.msu.ru/ )

• http://master.cmc.msu.ru/files/computer_architecture.pdf
• http://master.cmc.msu.ru/files/bigdata-annot.pdf

ВМиК-Online! ... Студенты . ... Выпускники . Работа . ... Компания HP создает новые возможности для того, чтобы технологии приносили максимальную пользу людям, компаниям, государственным структурам и обществу в целом. ... Бизнес HP в России уже 6 лет подряд показывает результаты лучше рынка ИТ в целом. ... Вакансии компании Hewlett-Packard: . ... Телефон компании HP: +7 (495) 797-35-00. ... МГУ . ... Рейтинг компаний составляется на основе данных Клуба выпускников МГУ . ... 2001 2012 ВМиК Online! ...

Еще в разделе: (Показать все результаты (>35) - www.cmc-online.ru/ )

• ВМиК - Online! : Интересно - Лекция Microsoft: Future Directions in Computer
• ВМиК - Online! : Работа для выпускников и студентов ВМК МГУ - Kelly Services

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>25) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Home News Program Committee Organizing Committee Program Plenaries Special Sessions Registration Abstracts Accommodation Important dates Contacts Poster Links Conference Venue Video . Program . The program of the conference comprises plenary talks (50 min), section talks (45 min and 20 min) and poster presentations. ... Patrial Differential Equations . ... Special session "Control and Optimization in Partial Differential Equations" . ... Combinatorial and Toric Topology . ...

Еще в разделе: (Показать все результаты (>52) - pont2008.cmc.msu.ru/ )

• Program Международная конференция Дифференциальные уравнения и топология ,
• On mathematical creative work of L.S. Pontryagin (By D.V. Anosov) International
• International Conference Differential Equations and Topology dedicated to the

... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...

Еще в разделе: (Показать все результаты (>5) - composite.msu.ru/ )

... Кафедра математического моделирования и информатики . ... Добро пожаловать на сайт кафедры математического моделирования и информатики , заведующий кафедрой ? ... студент младших курсов и хотите делать у нас курсовую или поступать к нам, ознакомьтесь с основными направлениями деятельности кафедры и предлагаемыми темами курсовых работ. Может быть, вам нужны материалы по программированию , теории вероятностей , специальным курсам или математическим дисциплинам по выбору . ... Программирование . ...

Еще в разделе: (Показать все результаты (>6) - cmp.phys.msu.ru/ )

• Welcome! | Chair of Computer Methods of Physics
• User account | Chair of Computer Methods of Physics
• Contacts | Chair of Computer Methods of Physics

... Поиск по МГУ | Лента новостей | ... Форумы > Новости МГУ > Тема . ... Презентация по машинному переводу от Google на коллоквиуме по базам данных в МГУ . 2-го июня в 11:00 во 2-м учебном корпусе МГУ (здание факультета ВМиК МГУ) состоится презентация исследователя из Нью-Йоркского отделения Google на тему: "Building a Large-Scale Machine Translation System" ("Построение масштабируемой системы машинного перевода"). ... 2003 2011 MsuNews.Ru Новости МГУ . ... Экспорт новостей (RSS) ...

Еще в разделе: (Показать все результаты (>104) - www.msunews.ru/ )

... Alexander A. Moskovsky . ... Software Designer : . ... Projects: . Janitor II, Custodian III for Matrix Logic - utilities for DOCS Open EDMS (electronic document management system), C++/Win32 platform. ~2 man-year project with 5 persons team. iBuzz - (for ibuzz.com ) large client-server system (Win32, Enterprize Java Beans, Oracle, Sun/Solaris). ... Lunch Ordering Web System. ... Software Resources International , former Digital Moscow Software Center, . ... Physical Chemistry chair, . ...

Еще в разделе: (Показать все результаты (>20) - lcc.chem.msu.ru/ )

• Current Projects

... 3 ­ Sternberg State Astronomical Institute, Moscow, :jeanna@sai.msu.ru The graphic method of the analysis of an arrangement of linear structural elements on geographical and geological maps of continents (A.V.Dolitsky, [1]) has allowed to find out global stress fields of the past and among them one which directions (the main normal and maximal tangents) describe more than 80 % of all linear elements of a relief. ... The found poles share program way on density of an arrangement on 3-4 groups. ...

Еще в разделе: (Показать все результаты (>84) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Laz/Publications/6_Automatic%20creation%20of%20the%20hypsometric%20map%20of%20Venus.pdf

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

Еще в разделе: (Показать все результаты (>2) - saistud.sai.msu.ru/ )

... TernAPI program . ... TernAPI program is designed for ternapy phase diagrams calculation by means of the convex hull method. ... Quick calculation of isobaric-isothermal sections of ternary systems phase diagrams (1-30 sec.) ... Voskov A.L., Dzuban A.V., Maksimov A.V. TernAPI program for ternary phase diagrams with isolated miscibility gaps calculation by the convex hull method // Fluid Phase Equilib . ... Colloquium on 24.12.12 20 Dec 2012 . ... Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>92) - td.chem.msu.ru/ )

• PhDi Laboratory of Chemical Thermodynamics

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>4) - sinp.msu.ru/ )

... Reports on progress and error are always recorded in the log file of the program. ... UT date of the measurement finish in YYYY-MM-DD format UT time of the measurement finish in hh:mm:ss format Average flux in A aperture Average flux in B aperture Average flux in C aperture Average flux in D aperture Normalized variance of flux in A aperture Normalized variance of flux in B aperture Normalized variance of flux in C aperture Normalized variance of flux in D ...

Еще в разделе: (Показать все результаты (>38) - curl.sai.msu.ru/ )

• http://curl.sai.msu.ru/mass/download/doc/dimm_soft_description.pdf
• http://curl.sai.msu.ru/mass/download/doc/res2007eng.pdf
• . The . MASS . Group .

... International Relations in Context of Global Processes - 17| ... GLOBAL ECONOMIC AND POLITICAL TRENDS Prof. Olga Y. Kornienko Economic literature survey Week 1 (4 academic hours ) 1) Current trends of global economy Week 2 (4 academic hours ) 2) Migration, population and globalization Week 3 (4 academic hours ) 3) Corporate culture and management: new trends Week 4 (4 academic hours ) 4) Development markets in global environment Week 5 (4 academic ... Models of the global world. ...

Еще в разделе: (Показать все результаты (>1647) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2014/03/Information-Sheet.pdf
• http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-1.pdf

... My field of specialization is Stability Theory, Nonlinear Dynamics, Asymptotic Methods, Mechanics of Solids, System Identification, Optimal Control, Economic Growth. ... A.O. Belyakov and A.P. Seyranian (2012). ... A.O. Belyakov and A.P. Seyranian, . ... A.P. Seyranian and A.O. Belyakov, Swing dynamics. ... A.O. Belyakov, A.P. Seyranian, and A. Luongo, Regular and chaotic dynamics of the swing. 6th EUROMECH Nonlinear Dynamics Conference (ENOC 2008) , Saint Petersburg, Russia, June, 30 - July, 4 2008...

Еще в разделе: (Показать все результаты (>8) - belyakov.imec.msu.ru/ )

... if (B1) { S1; } if (B1) { S1; } if (B2) { S2; } - - ...exp... int x = 1; if (x == 1) { std::cout << "Okay" << std::endl; } else { std::cout << "Error" << std::endl; } -- ­ int strlen(const char* p) { int len = 0; do { ++len; } while (*p++); return len; } «», «bbb» -- , : · ­ , , · ­ , , · ­ , · ­ . ... 1977 ­ LTL, · , 1981 ­ (CTL), · , , 1981 , , 1982 ­ model checking ( ), · , 1986 ­ model checking ( ), · , 1989 ­ SPIN. ... The Spin Model Checker: Primer and Reference Manual, Addison Wesley, 2003. ...

Еще в разделе: (Показать все результаты (>3) - savenkov.lvk.cs.msu.su/ )

... GLOBAL SOIL CHANGE: TIME-SCALES AND RATES OF PEDOGENIC PROCESSES (GSC-MEXICO-2005) . With pre-and post-conference field trips Montecillo, Mexico, March 29-April 06, 2005 . ... Chairmen: Prof., Dr. Benjamin Figueroa Sandoval, Director Central, Colegio de Postgraduados, Montecillo, Texcoco, Mexico, e-mail: Benjamin@colpos.colpos.mx . ... I intend to participate in the International Conference "Global Soil Change: Time-scales and Rates of Pedogenic Processes" in Mexico, March 29 - April 06, 2005 . ...

Еще в разделе: (Показать все результаты (>185) - www.fadr.msu.ru/ )

• Foundation for Agrarian Development Research - Colocation
• INTERNET AS A NEW FACTOR OF AGRARIAN DEVELOPMENT
• THE ESTABLISHMENT OF THE ALBANIAN MARKET INFORMATION SERVICE